We narrowed to 10,361 results for: POR
-
Plasmid#224697PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro active protease with His-tagDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsGly-Gly-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(K35A/K68A/K72/PAMmut)
Plasmid#176140PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutations Lys35Ala, Lys68Ala, Lys72Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resisDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutations Lys35 to Ala, Lys6…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 cysteineless (NT868)
Plasmid#49079PurposeExpresses human NKCC1 mutant lacking cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC295A, C543M, C563S,C568S,C577S,C582S, C630S, C72…PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
UQ5875
Bacterial Strain#37167DepositorBacterial ResistanceAmpicillin and KanamycinAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
UQ5877
Bacterial Strain#37172DepositorBacterial ResistanceAmpicillin and KanamycinAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_p53(R280K)_V5
Plasmid#136525PurposeUsed as a donor vector to clone into pSLIKDepositorInsertp53(R280K) (TP53 Human)
UseGateway CloningTagsV5Mutationp53(R280K)V5 was cloned from pLenti6-p53-R280K-V5…AvailabilityAcademic Institutions and Nonprofits only -
UQ6177
Bacterial Strain#37179DepositorBacterial ResistanceAmpicillin and KanamycinAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
UQ6148
Bacterial Strain#37178DepositorBacterial ResistanceAmpicillin and KanamycinAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro_C145A-HIS
Plasmid#224698PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro inactive protease with His-tagDepositorInsertSARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsGly-Gly-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Synthetic, Human)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), M163A (EcI) MetNIQ in pBAD
Plasmid#118261PurposeN295A Mutation of MetN and M163A in MetI in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), M107A (EcI) MetNIQ in pBAD
Plasmid#118259PurposeN295A Mutation of MetN and M107A in MetI in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), F103A (EcI) MetNIQ in pBAD
Plasmid#118258PurposeN295A Mutation of MetN and F103A in MetI in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTHC_PGKneoLox2DTA.2
Plasmid#112624PurposeH2BmTeal_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsmTeal (mTFP1)PromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
UQ6211
Bacterial Strain#37180DepositorBacterial ResistanceAmpicillin and KanamycinAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
UQ6139
Bacterial Strain#37177DepositorBacterial ResistanceAmpicillin and KanamycinSpeciesBurkholderia xenovoransAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only