We narrowed to 1,566 results for: aav vector plasmid
-
Plasmid#170175PurposeCation channelrhodopsin ChroME2f targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME2f-ST-P2A-NLS-mRuby3
UseAAVExpressionMammalianAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130993PurposeAAV vector to drive the expression of soma-targeted ChRmine-eYFP under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1PromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
Plasmid#141236PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertNES-jRGECO1a
UseAAV and Cre/Lox; Cre-offTags6xHIS tag and nuclear export signalPromoterhuman elongation factor-1 alpha (EF-1 alpha)Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130989PurposeAAV vector to drive the expression of soma-targeted ChRmine-eYFP under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1PromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC809 - pAAV-EF1a-CRTsigpep-GCaMP3-KDEL
Plasmid#63884PurposeAn AAV packaging vector that expresses ER-retained GCaMP3 under control of the EF1a promoter.DepositorInsertER-localized GCaMP3(wt)
UseAAVPromoterEF1aAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Pgc-1alpha-EYFP
Plasmid#241793PurposeExpression vector for mouse Pgc-1alpha with EYFPDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA
Plasmid#68719PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6f from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6f
UseAAVPromoterCAG-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TPH2-Cre
Plasmid#189616PurposeExpresses Cre recombinase under the control of the tryptophan hydroxylase promoterDepositorInsertCre Recombinase
UseAAVExpressionMammalianPromoterTph2Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-EGFP-P2A-EGFPf-WPRE-HGHpA
Plasmid#74513PurposeAAV vector that use human synapsin-1 promoter to drive the expression of EGFP and membrane-targeted EGFPf linked by self-cleaving P2A peptide.DepositorInsertEGFP-p2A-EGFP-f
UseAAVAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3
Plasmid#108912PurposeCation channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorHas ServiceAAV9InsertChroME-ST
UseAAVPromoterCAGAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111581PurposeAn AAV vector that expresses double floxed myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-fDIO-mem-seTurboID-IRES-tTA
Plasmid#237889PurposeAmplifier AAV vector of Dual-AAV sparse labeling system encoding membrane-tethered seTurboIDDepositorInsertmem-seTurboID
UseAAVTagsFLAG tag and GAP43 palmitoylation signalExpressionMammalianPromoterTREAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CK(0.4)-CRY2PHR-P2A-CIBN-mCherry-VAMP2
Plasmid#178576PurposeAAV vector for CK(0.4)::Opto-vTrapDepositorInsertCRY2PHR-P2A-CIBN-mCherry-VAMP2
UseAAVPromoterCamKIIaAvailable SinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST
Plasmid#109048PurposeAnion channelrhodopsin GtACR1 fused to ER export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome entry sequence in a viral vectorDepositorHas ServiceAAV9InserteGtACR1-ST
UseAAVPromoterCAGAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-1 target sites
Plasmid#120299PurposeAAV vector for expression of AcrIIA4 with two miR-1 binding sitesDepositorInsertAcrIIA4-2xmiR-1 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-ASAP3Kv-WPRE
Plasmid#132330Purposeexpresses ASAP3Kv(soma-located version of ASAP3, ASAP-family genetically encoded voltage indicator) in cre recombinase expressing mouse/cell, gene delivered by pAAV-EF1a vectorDepositorInsertASAP3KV
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only