We narrowed to 58,681 results for: plasmid
-
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV9)
Viral Prep#113050-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
CRISPRainbow Kit for Multiplex Labeling
Plasmid Kit#1000000079PurposePlasmids using dCas9 and gRNA scaffolds that bind fluorescent proteins to label multiple chromosomal loci.DepositorApplicationGenome EditingVector TypeLentiviral, Mammalian ExpressionEditing TypeCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
p11-LacY-wtx1
Plasmid#69056PurposeThe reporter plasmid p11-LacY-wtx1 encodes the toxin CcdB gene under the inducible BAD promoter and a single copy of the endonuclease cleavage site which is readily extendable to multiple copies.DepositorAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TLR targeting vector
Plasmid#64215PurposeTargeting vector for the human AAVS1 locus for insertion of traffic light reporter (TLR) constructDepositorInserttraffic light reporter (TLR) (AAVS1 Human)
UseHuman targetingMutationsee publication for detailsPromoterCAGAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCM157
Plasmid#45863DepositorInsertcre recombinase
UseCre/LoxExpressionBacterialPromoterlacAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
Luciferase-pcDNA3
Plasmid#18964DepositorInsertFirefly Luciferase
ExpressionMammalianAvailable SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCFJ104 - Pmyo-3::mCherry::unc-54
Plasmid#19328DepositorArticleInsertPmyo-3::mCherry
TagsmCherryExpressionWormAvailable SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO mCherry (AAV5)
Viral Prep#114471-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-fDIO mCherry (#114471). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO mCherry plasmid DNA. Ef1a-driven, Flp recombinase-dependent expression of mCherry. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Flp-dependent)Available SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSIP403
Plasmid#122028PurposePlasmid for expression of gene of interest in Lactobacillus plantarum and L. sakeiDepositorInsertgusA
ExpressionBacterialPromotersppAAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV2)
Viral Prep#51502-AAV2PurposeReady-to-use AAV2 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (AAV1)
Viral Prep#50942-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (#50942). In addition to the viral particles, you will also receive purified pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA plasmid DNA. GCaMP6s calcium sensor and bicistronic, physically separate mRuby2 expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmRuby2Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCAS9-VP64_GFP (Concentrated Lentiviral Prep)
Viral Prep#61422-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from dCAS9-VP64_GFP (#61422). In addition to the viral particles, you will also receive purified dCAS9-VP64_GFP plasmid DNA.DepositorPromoterEF1aAvailable SinceAug. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ90 - Pmyo-2::mCherry::unc-54utr
Plasmid#19327DepositorArticleInsertPmyo-2::mCherry
ExpressionWormAvailable SinceOct. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Flpe
Plasmid#13787PurposeMammalian expression of enhanced form of Flp recombinase with C-terminal Myc tagDepositorInsertFlpe
TagsMycExpressionMammalianPromoterCAGAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-cmyc
Plasmid#16011Purposemammalian expression of human cmycDepositorInsertcmyc (MYC Human)
ExpressionMammalianAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV9)
Viral Prep#154951-AAV9PurposeReady-to-use AAV9 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Con/Fon-GCaMP6M (AAV8)
Viral Prep#137119-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-EF1a-Con/Fon-GCaMP6M (#137119). In addition to the viral particles, you will also receive purified pAAV-EF1a-Con/Fon-GCaMP6M plasmid DNA. EF1a-driven, Cre and Flp-dependent expression of GCaMP6M. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1-SIO-stGtACR2-FusionRed (AAV Retrograde)
Viral Prep#105677-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV_hSyn1-SIO-stGtACR2-FusionRed (#105677). In addition to the viral particles, you will also receive purified pAAV_hSyn1-SIO-stGtACR2-FusionRed plasmid DNA. Synapsin-driven, Cre-dependent, soma-targeted anion-conducting channelrhodopsin fused to FusionRed for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsFusionRed (Cre-dependent)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (AAV5)
Viral Prep#105540-AAV5PurposeReady-to-use AAV5 particles produced from pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (#105540). In addition to the viral particles, you will also receive purified pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 plasmid DNA. Expression of EGFP-Cre from hSyn promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceMay 26, 2020AvailabilityAcademic Institutions and Nonprofits only