We narrowed to 13,850 results for: sequence
-
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Rat, Synthetic)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for caspase-1
Plasmid#60885PurposeFPX biosensor for caspase-1DepositorInsertsingle polypeptide FPX biosensor for caspase-1
TagsHindIII site and NES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC9A2
Plasmid#132222PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC9A2 (SLC9A2 Human)
ExpressionMammalianAvailable SinceNov. 7, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC25A10
Plasmid#132014PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC25A10 (SLC25A10 Human)
ExpressionMammalianAvailable SinceOct. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastBac1-His10TEV
Plasmid#159427Purposeempty pFastBac1 vector (polyhedrin promoter) adds TEV-protease-removable N-terminal His10-tag; avoids unwanted residues in the final protein sequence by using the BseRI restriction sitesDepositorTypeEmpty backboneTagsTEV-protease-cleavable His10-tagExpressionInsectPromoterpolyhedrinAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRM919_WT aa 1-419 His POLI
Plasmid#201445PurposeLow copy vector for expressing the catalytic domain (amino acids 1-419) of human DNA polymerase iota in E. coli with an N-terminal 6x His tag. C-terminal truncation mutant of pJRM919_WT His POLIDepositorInsertDNA polymerase iota (POLI Human)
Tags6x HisExpressionBacterialMutationExpresses amino acids 1-449 of DNA polymerase iot…Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC6A14
Plasmid#131865PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC6A14 (SLC6A14 Human)
ExpressionMammalianAvailable SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC38A8
Plasmid#132082PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC38A8 (SLC38A8 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-Bcl2-Cb5
Plasmid#18000DepositorInsertER targeted Bcl-2 (BCL2 Human)
TagsGFPExpressionMammalianMutationBcl-2's C terminal targeting sequence replac…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC44A2
Plasmid#132214PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC44A2 (SLC44A2 Human)
ExpressionMammalianAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
CaV1.3e[8a,11,31b,Δ32,Δ42a]
Plasmid#49332PurposeRepaired Addgene #26577 to agree with the rat ref sequence. Repairs are @: nt 6224 (GCC->GTC) [Ala->Val]; nt 3310 (GTG->GCG) [Val->Ala]; nt 731 (TCA->GGA) [Ser->Gly].DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, and 31b.Exons 32 and 42a a…PromoterCMVAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl2-Maob
Plasmid#18001DepositorInsertMitochondria-targeted Bcl-2 (BCL2 Human)
TagsGFPExpressionMammalianMutationBcl-2's C terminal replaced with mitochondri…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
FRB-TagRFPT-CAAX
Plasmid#87710PurposeFRB-tagged TagRFPT; targeted to plasma membrane.DepositorInsertFRB-TagRFPT-CAAX
Tags6xHis, C-terminal targeting sequence from Kras, T…ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC30A3
Plasmid#132101PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC30A3 (SLC30A3 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Tnnt2 -Atp2a2-HA
Plasmid#227804Purposecardiomyocytes-specific plasmid with Tnnt2 promotor, expressing the coding sequence of mouse Atp2a2 and a HA tagDepositorAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-xFNLS-P2A-Puro
Plasmid#110872PurposeLentiviral vector for constitutive expression of xFNLS in mammalian cells (codon optimized)DepositorInsertxFNLS(3.7)
UseLentiviralTags3X FLAGMutationD10A, A262T, R324L, S409I, E480K, E543D, M694I, E…PromoterEF1sAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1RA-P2A-GFP-PGK-Puro
Plasmid#110866PurposeLentiviral vector for constitutive expression of Cas9-HF1RA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-HF1RA
UseLentiviralTagsFLAGMutationR661A, Q695A, Q926A, and NLS sequence at the N-te…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC2A2
Plasmid#132126PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC2A2 (SLC2A2 Human)
ExpressionMammalianAvailable SinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits