We narrowed to 23,671 results for: CRISPR
-
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-3sgRNA
Plasmid#88850PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-4sgRNA
Plasmid#88851PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC197 - Bacterial expression plasmid for SpCas9 Cluster 2 + Q926A variant
Plasmid#101232PurposeBacterial expression plasmid for SpCas9 Cluster 2 + Q926A variantDepositorInsertSpCas9 variant G528A/V583A/E584A/D585A/N588A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationG528A, V583A, E584A, D585A, N588A and Q926APromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-5F5-mCherry
Plasmid#73422PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 5F5.DepositorInsertPromoter 5F5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP5F5 (orthogonal T7-lac variant)Available SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC011 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variant
Plasmid#101229PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N692A/M694A/Q695A/H698A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N692A, M694A, Q695A an…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eLaTranC
Plasmid#246932Purposefor HEK293T human cell genome editingDepositorInserteLaTranC
UseCRISPRAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-sgRNA
Plasmid#246933Purposefor HEK293T human cell genome editingDepositorInsertLaTranC sgRNA
UseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-LaTranC
Plasmid#246931Purposefor HEK293T human cell genome editingDepositorInsertLaTranC
UseCRISPRAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-ZIM3-Cas9-P2A-GFP
Plasmid#239605PurposeDoxycycline inducible CRISPRgenee constructDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-ZIM3-Cas9-P2A-GFP-PGK-Blasti
Plasmid#239604PurposeDoxycycline inducible CRISPRgenee construct with a blasticidin resistanceDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-ZIM3-Cas9-P2A-GFP-PGK-Blasti
Plasmid#239610PurposeConstitutive active CRISPRgenee construct with a blasticidin resistanceDepositorInsertZIM3 KRAB domain (ZIM3 )
UseCRISPR and LentiviralAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-Dual_filler(hU6_H1/7SK hybrid)-EF1as_Thy1.1_P2A_Neo
Plasmid#239609PurposeBackbone for the cloning of a dual sgRNA expression plasmid (hU6 and minimal H1/7SK hybrid promoters) using BsmbI. Selectable with a G418 resistanceDepositorInsertfiller-trcr-H1/7SKhybrid-filler
UseCRISPR and LentiviralAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW281_dSpRY
Plasmid#244822PurposeMammalian expression of catalytically inactive SpRY Cas9 (dSpRY)DepositorInsertdSpRY Cas9
UseCRISPRTags3xFLAG-SV40 NLS and Nucleoplasmin NLSExpressionMammalianMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterCAGAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-Dual_filler(hU6_H1)-EF1a-Thy1.1-P2A-Neo
Plasmid#239608PurposeBackbone for the cloning of a dual sgRNA expression plasmid (hU6 and H1 promoters) using BsmbI. Selectable with a G418 resistanceDepositorInsertfiller-trcr-H1-filler
UseCRISPR and LentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS484_10xHis_MBP_TEV_dSpRY
Plasmid#244832PurposeBacterial expression of catalytically inactive SpRY Cas9 (dSpRY) for protein purificationDepositorInsertdSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS71_10xHis_MBP_TEV_WT-Cas9_2xNLS
Plasmid#244833PurposeBacterial expression of SpyCas9 (WT) with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpyCas9 (WT)
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS23_10xHis_MBP_TEV_SpG-Cas9
Plasmid#244826PurposeBacterial expression of SpG Cas9 for protein purificationDepositorInsertSpG Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only