We narrowed to 11,227 results for: CHL
-
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-BAP1-G312G-HA
Plasmid#154022PurposeMammalian Expression of HA-tagged BAP1 with the Synonymous Mutation p.G312GDepositorInsertBAP1 (BAP1 Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationc.936T>G, p.G312G (Synonymous Mutation) by Sit…Available SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
shCCL20
Plasmid#65096Purposeretroviral expression of CCL20 shRNADepositorAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NES-YFP-CCTd
Plasmid#184326PurposeMammalian expression of the cytosolic localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NLS-YFP-CCTd
Plasmid#184325PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
Plasmid#195047Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pXYL-crtE-tNOS-pGPD-crtI-tNOS-pADH2-crtYB-tNOS+ku70 insD (SBE144)
Plasmid#195046Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV PE2
Plasmid#206276PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes PE2 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertPE2
UseCRISPR; Recombinant baculovirus production, multi…ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NLS-YFP-CCTc
Plasmid#184327PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.2)DepositorInsertCCTc (CACNA1C Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11
Plasmid#154025PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 11DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7
Plasmid#154023PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 7DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA targeting human SLC12A5 gene stop codon
Plasmid#158577PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInsertsgRNA targeting human SLC12A5 gene stop codon
UseCRISPRTagsCas9 and GFPExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only