We narrowed to 12,674 results for: nsf
-
Plasmid#230932PurposeUsed for producing AAV-CMV-eGFP viruses with the AAVtri triple-plasmid system. This system combines the use of the mini-pHelper-1.0 and AAV helper plasmids carrying different AAV serotypes.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTight-9-124-BclxL
Plasmid#60857Purpose2nd generation lentiviral transfer plasmid. Expresses a synthetic cluster of miR-9/9* and miR-124 fused to Bcl-xL under a doxycycline-inducible promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-rsChRmine-oScarlet-Kv2.1-WPRE
Plasmid#183529PurposeOptogeneticsDepositorInsertrsChRmine-oScarlet-Kv2.1
UseAAVMutationI146M/G174SPromoterEf1aAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mTagBFP2-CAAX2 WPRE
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-Jaws-KGC-GFP-ER2
Plasmid#65014PurposeAAV-mediated expression of Jaws under the human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV5, and AAV8InsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterhuman synapsinAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRM210 LGP (Luciferase GFP Puro)
Plasmid#174722PurposeExpresses the firefly luciferase gene, E2A, eGFP, F2A, and the puromycin resistance geneDepositorInsertsFirefly Luciferase
eGFP
pac
UseLentiviral and LuciferaseTagsE2A linker and F2A linkerExpressionMammalianPromoterMND, MND (off Luc-E2A), and MND (off Luc-E2A-eGFP…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1
Plasmid#83900PurposeGFP expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserteGFP
UseAAVPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
Plasmid#236246PurposeEndogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membraneDepositorInsertgRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE
Plasmid#162380PurposeAAV-mediated expression of ultrafast protein calcium sensor under the CAG promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertjGCaMP8s
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationS26M F286Y Q315HPromoterCAGAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-ChR2-mCherry-Fishell-3
Plasmid#83898PurposeChR2-mCherry fusion expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertChR2
UseAAVExpressionMammalianPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVone-AAV-PHP.eB-CMV-eGFP
Plasmid#230929PurposepAAVone plasmid is used to package AAV-CMV-eGFP with an AAV-PHP.eB serotype, utilizing the AAVone single-plasmid AAV production system.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINK-EF1alpha-HA-5'-TOP2B
Plasmid#244334Purpose5' AAVLINK plasmid for TOP2B expressionDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-DIO-PinkyCaMP
Plasmid#232857PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under Syn promoter in a Cre-dependent manner (DIO, double floxed inverted open reading frame)DepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-i53
Plasmid#92170Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant (i53) that is a selective inhibitor of 53BP1DepositorInserti53
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable SinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV hSyn INTRON mScarlet-CAAX2 WPRE
Plasmid#236232PurposeAAV expression of a fluorescent marker, mScarletI, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmScarletI fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmScarletIPromoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_P2A_Puro
Plasmid#211364PurposeLentiviral expression vector for an insert of interest linked to a P2A-T2A puromycin sequence. Produces virus very efficiently. Can also be used for regular transfectionsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.eGFP.2A.P301L-Tau
Plasmid#140425PurposeAAV.CBA.eGFP.2A.P301L-Tau propagation reporter P301L-2N4R-hTauDepositorInserteGFP-2A-Tau(P301L) (MAPT Human, Synthetic)
UseAAVTagseGFPMutationchanged Proline 301 to LeucinePromoterCBAAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only