We narrowed to 1,165 results for: SAM-2;
-
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pEMS1651
Plasmid#29286PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle179 (CLVS2 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1652
Plasmid#29287PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle180 (CLVS2 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1653
Plasmid#29288PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle181 (CLVS2 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceJune 10, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-LRRK2
Plasmid#229019PurposeExpression of untagged full length human LRRK2 in mammalian cellsDepositorInsertLeucine-rich repeat kinase 2 (LRRK2 Human)
Tagsno tags (untagged)ExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ISG
Pooled Library#125753PurposeKnockout library targeting a set of human interferon-stimulated genes (ISGs).DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307 hDVL1
Plasmid#102863PurposeExpresses human DVL1 in mammalian cellsDepositorInserthuman Dishevelled 1 (DVL1) (DVL1 Human)
UseLentiviralExpressionMammalianMutationChanged alanine 2 to glycine. Likely due to poly…PromoterEF1AAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
Plasmid#245063PurposeAAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.DepositorInsertAAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry (Adra2a Synthetic, Mouse)
UseAAV, Cre/Lox, and RNAiPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
Plasmid#199551PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1β-hHNF4α-hHNF6) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
delta guaB
Bacterial Strain#113653PurposeBase strain that the pDCAF plasmids (Addgene #113646-113652) must be in.DepositorBacterial ResistanceKanamycinAvailable SinceNov. 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Antibody#240998-rAbPurposeAnti-Glypican 2 (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for mouse GPC2. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityMouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pHAGE-FGFR1
Plasmid#116740PurposeLentiviral expression of FGFR1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#237809-rAbPurposeAnti-Neurexin-2b (human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN2b. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceNov. 11, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Lourido Toxoplasma CRISPR Library V1
Pooled Library#80636PurposeKnockout library targeting 8,158 predicted protein-coding gene in Toxoplasma gondii.DepositorAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Antibody#211756-rAbPurposeRecombinant mouse monoclonal Anti-SARS-CoV-2 nucleocapsid protein antibodyDepositorRecommended ApplicationsWestern BlotSource SpeciesMouseIsotypeIgG2aTrial SizeNot available to purchaseAvailable SinceMarch 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#211757-rAbPurposeRecombinant mouse monoclonal Anti-SARS-CoV-2 nucleocapsid protein antibodyDepositorRecommended ApplicationsWestern BlotSource SpeciesMouseIsotypeIgG2aTrial SizeNot available to purchaseAvailable SinceMarch 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits