We narrowed to 14,334 results for: cas9 genes
-
Plasmid#145122PurposeExpressing base editor A3A-R128A-BE3 in yeast cellsDepositorInsertA3A(R128A)-BE3
UseCRISPRExpressionYeastMutationA3A(R128A); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT113_GalL_cCDA1-xBE3
Plasmid#145079PurposeExpressing base editor cCDA1-xBE3 in yeast cellsDepositorInsertcCDA1-xBE3
UseCRISPRExpressionYeastMutationspCas9(D10A, A262T, R324L, S409I, E480K, E543D, M…PromoterGalLAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC EJ7-GFP
Plasmid#113617PurposeReporter for canonical-NHEJ. Reporter for end joining between two double-strand breaks, induced with the 7a and 7b sgRNAs with CAS9. EJ between the distal ends w/o indel mutations restores GFPDepositorInsertEJ7-GFP variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ204-loxP-EF1a-tagBFP-HygR-lox2272-BGHpA-siteT9-HDR
Plasmid#154827PurposeLanding pad for Cre/lox-based recombinase-mediated cassette exchange (RMCE) in CHO cells, donor plasmid for CRISPR/Cas9-mediated targeted integration in CHO cells (site T9)DepositorInsertsTagBFP
HygR
ZsGreen1-DR
UseCRISPR and Cre/LoxTagsPESTExpressionMammalianPromoterCMV, EF1a, and SV40 early promoterAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC 4-μHOM
Plasmid#113619PurposeReporter for Alt-EJ, variant of EJ7-GFP. Double strand breaks are induced with the 7a & 7h, or 7a & 7i sgRNAs, with CAS9. EJ using 4 nt of microhomology causes a deletion mutation and restores GFPDepositorInsert4-μHOM variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ204-loxP-EF1a-mCherry-NeoR-lox2272-BGHpA-siteA-HDR
Plasmid#154826PurposeLanding pad for Cre/lox-based recombinase-mediated cassette exchange (RMCE) in CHO cells, donor plasmid for CRISPR/Cas9-mediated targeted integration in CHO cells (site A)DepositorInsertsmCherry
NeoR
ZsGreen1-DR
UseCRISPR and Cre/LoxTagsPESTExpressionMammalianPromoterCMV, EF1a, and SV40 early promoterAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE4396
Plasmid#74041PurposeExpresses human codon-optimized AsCpf1 and As crRNA.DepositorInsertsAs crRNA
AsCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre stuffer v3
Plasmid#158030Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
LCV2 control
Plasmid#217443PurposeLentiviral vector expressing Cas9 without a targeting sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon4
Plasmid#217455PurposeFor TP53 knockout targeting exon 4 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-NW5
Plasmid#240619PurposeAdenine base editor with narrowed editing windowDepositorInsertTadA8e(R74Q)-linker-nCas9 (D10A)
UseCRISPRExpressionMammalianMutationTadA8e(R74Q), Cas9 (D10A)Available SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-CB5
Plasmid#171007PurposeHiLITR protease with CB5 C-terminal tmd targeting information (ER)DepositorInsertEGFP-uTEV1-CB5(tmd)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330-CD4
Plasmid#136938PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human CD4; induce CD4+ deletion rearrangement by pairing w/ px330-GAPDHDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-NES
Plasmid#171006PurposeHiLITR protease with C-terminal NNES (Cytoplasmic)DepositorInsertEGFP-uTEV1-NES
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-1
Plasmid#74960PurposeCas9 + sgGFP-1 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only