We narrowed to 1,598 results for: cag promoter
-
Plasmid#118157PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-mScarletI
Plasmid#217783PurposeExpresses CRISPRoff-mScarletI (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-mScarletI-KRAB) downstream of the CAG promoter for gene epigenetic silencingDepositorInsertCRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
Tags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and mScarletIExpressionMammalianPromoterCAGAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_Dual_sgRNA
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Dual_pegRNA
Plasmid#173199PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-1
Plasmid#121533PurposesgITGB1-1 sequence: GAAGCAGGGCCAAATTGTGGG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-Casp2-shRNA
Plasmid#157926PurposeKnockdown of caspase-2DepositorAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G3_Dual_sgRNA
Plasmid#173205PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPsgRNA
Plasmid#126610PurposeExpresses CNP sgRNA under mouse U6 promoterDepositorAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A-F1359A-siRNAres_K
Plasmid#146744PurposeMammalian Expression of HsTNRC6A-F1359A-siRNAresDepositorInsertHsTNRC6A-F1359A-siRNAres (TNRC6A Human)
ExpressionMammalianMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A-del1352-1369-siRNAres_K
Plasmid#146743PurposeMammalian Expression of HsTNRC6A-del1352-1369-siRNAresDepositorInsertHsTNRC6A-del1352-1369-siRNAres (TNRC6A Human)
ExpressionMammalianMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1242-1709-F1359A_K
Plasmid#146742PurposeMammalian Expression of HsTNRC6A_1242-1709-F1359ADepositorInsertHsTNRC6A_1242-1709-F1359A (TNRC6A Human)
ExpressionMammalianMutationfive non silent mutations D1289G, G1515A, S1516G,…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only