We narrowed to 15,178 results for: GRN
-
Plasmid#211545PurposesgRNA-B against RAD1DepositorInsertsgRNA RAD1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gRAD9A_A
Plasmid#211611PurposesgRNA-A against RAD9DepositorInsertsgRNA RAD9A
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gRAD1_A
Plasmid#211544PurposesgRNA-A against RAD1DepositorInsertsgRNA RAD1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gHUS1_B
Plasmid#211542PurposesgRNA-B against HUS1DepositorInsertsgRNA HUS1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gIL25_A
Plasmid#211543PurposesgRNA-A against IL25DepositorInsertsgRNA IL25
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-sgNCF1
Plasmid#190193PurposeExpresses a gRNA for base editing the Kozak sequence of the human NCF1 geneDepositorInsertgRNA sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#2
Plasmid#174143PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgSLC35B2
Plasmid#83932PurposeLentiviral vector expressing an sgRNA targeting SLC35B2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgSLC35B2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgTPST2
Plasmid#83933PurposeLentiviral vector expressing an sgRNA targeting TPST2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgTPST2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-2
Plasmid#83935PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-3
Plasmid#83936PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(NT:NT)
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ZNF503_2
Plasmid#135755PurposeEncodes gRNA for 3' target of human ZNF503DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ZNF503_1
Plasmid#135754PurposeEncodes gRNA for 3' target of human ZNF503DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB700-TTN-Puro
Plasmid#128323PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)DepositorInsertgRNA against human TTN for activation
ExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
PX458_ZNF511_1
Plasmid#104044PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only