We narrowed to 61,398 results for: promoter
-
Plasmid#232438PurposesgRNA to facilitate a splice donor site disruption via adenine base editing in the B2M locus, contains a PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged gRNA for B2M disruption via splice donor consensus disruption via ABE8e or Cas9 driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
HECW2
Plasmid#32875PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceJan. 6, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3-FLIP pr5
Plasmid#19130DepositorInsertFLIP promoter (CFLAR Human)
UseLuciferaseExpressionMammalianMutationThe sequence corresponds to positions -503 to +28…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGL3-321/+120
Plasmid#35540DepositorUseLuciferaseTagsluciferasePromoternoneAvailable SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
-
AAV-CAG-jGCaMP8f-WPRE (AAV1)
Viral Prep#179254-AAV1PurposeReady-to-use AAV1 particles produced from AAV-CAG-jGCaMP8f-WPRE (#179254). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8f-WPRE plasmid DNA. CAG-driven expression of calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJET-osr1-KI-donor
Plasmid#184875PurposeDonor template for knock-in of p2a-CreERT2 into the medaka osr1 locus via CRISPR/Cas9-mediated homology directed repairDepositorInsertsOdd-Skipped Related Transcription Factor 1 5' homology arm
Odd-Skipped Related Transcription Factor 1 3' homology arm
p2a-CreERT2
Myosin light chain 2 promoter
EGFP
UseCRISPR and Cre/LoxAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DW164AA USP7
Plasmid#131252PurposeMammalian expression of N-terminally Myc-tagged DW164AA USP7DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationContains a point mutation that converts USP7 aspa…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
KG#371
Plasmid#110882PurposeExpresses the lysosome marker CTNS-1-mCherry cDNA in a subset of ventral cord cholinergic motor neuronsDepositorInsertsunc-129 promoter
CTNS-1a-mCherry cDNA
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
Tagsintron-mCherryExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(m40)-luc
Plasmid#12425DepositorInsertM-CSF receptor promoter fragment (CSF1R Human)
UseLuciferaseMutationPU.1 binding site mutation (created a KpnI site i…Available SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-1574/+120
Plasmid#35539DepositorUseLuciferaseTagsluciferasePromoternoneAvailable SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL3Luc-5XNF-kappaB
Plasmid#185695PurposeReporter plasmid with a double-strand oligonucleotides that contain five repeats of NF-kappaB binding consensus sequence (5'-GGGGAATTTCC-3').DepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-jGCaMP8s-WPRE (AAV1)
Viral Prep#179256-AAV1PurposeReady-to-use AAV1 particles produced from AAV-CAG-jGCaMP8s-WPRE (#179256). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8s-WPRE plasmid DNA. CAG-driven expression of calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLe6Δ -hLP-mcs/(EGFP-IresPuro-hInt)
Plasmid#64314Purposechondrocyte-specific COL11A2 promoter/enhancer lentiviral reporter vector to select iChon cellsDepositorUseLentiviralTagsEGFP and IRES-PUROExpressionMammalianMutationN/AAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-jGCaMP8f-WPRE (AAV Retrograde)
Viral Prep#179254-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-jGCaMP8f-WPRE (#179254). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8f-WPRE plasmid DNA. CAG-driven expression of calcium sensor GCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-XRE-dUnaG-PEST-Myc
Plasmid#252287PurposeReporter for Ahr activityDepositorInsertsXenobiotic Response Elements (XREs) core motif promoter
dUnaG-PEST-degron
UseLentiviralTagsc-myc tagPromoterXRE (Xenobiotic response element 5X + CMV minimal…Available SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only