We narrowed to 61,828 results for: promoter
-
Plasmid#137123PurposeIntersectional viral expression of GCaMP6F in cells expressing Cre AND NOT FlpDepositorHas serviceAAV8InsertCon/Foff 2.0-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationContains the V65I mutation that increases discrim…Available sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
UBC46
Plasmid#25470PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceAug. 23, 2010AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pEF1a-Usp9x_CD-mCherry
Plasmid#170380PurposeVector for mammalian expression of the Usp9x catalytic domain tagged with mCherry, in pEF1a-IRES-Neo backbone.DepositorInsertUbiquitin specific protease 9x catalytic domain (Usp9x Mouse)
TagsmCherry-3xFlagExpressionMammalianMutationCatalytic domainAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Burden Monitor phi80 version
Plasmid#66074PurposeThe burden monitor was cloned inside plasmid pAH153 [Haldimann2001]; the genome integration of the system allows the measurement of the burden imposed by synthetic constructs to Escherichia coli cellDepositorInsertGFP
Available sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-Ef1a-Con/Foff 2.0-mCherry
Plasmid#137133PurposeIntersectional viral expression of mCherry in cells expressing Cre AND NOT FlpDepositorHas serviceAAV8InsertCon/Foff 2.0-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE3 mutant
Plasmid#133310PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 3DepositorInserteIF3B promoter MBE3 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationccacgtgacc changed to cAaAAAAaccPromotereIF3BAvailable sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-BFP
Plasmid#137129PurposeIntersectional viral expression of BFP in cells expressing both Cre AND FlpDepositorHas serviceAAV8InsertCon/Fon-BFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-sRGECO
Plasmid#137126PurposeIntersectional viral expression of sRGECO in cells expressing both Cre AND FlpDepositorHas serviceAAV8InsertCon/Fon-sRGECO
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE217DPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDL0_243
Plasmid#210780PurposeC2_Endliker for the extension of cloning using pLac:AmilGFP as a visible marker for the cloningDepositorInsertC2-endlinker
UseSynthetic BiologyExpressionPlantAvailable sinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_AR-RE_MLPmin_BC1013-luc2
Plasmid#227107PurposeAndrogen receptor response element for luciferase and barcode assays; barcode BC1013DepositorInsert8x clustered AR response element linked to MLP minimal promoter driving barcode 1013 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable sinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_mpx_AsCas12a(dual-gRNA)_h7SK(PacI-ClaI)_U6(I-SceI-NheI)_PGK-puro
Plasmid#189635PurposeLentiviral expression of double dual-AsCas12a gRNAs for generating combinatorial AsCas12a 3Cs librariesDepositorInserth7SK arrayed Cas12a gRNA cassette, hU6 arrayed Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSecEffector
Plasmid#172891PurposeContains TEVp display cassette, atc inducible (in any E. coli strain) BxbI and arabinose inducible TP901DepositorInsertsBxb1
TP901
TEV Display cassette
ProD promoter between anti aligned Bxb1 sites
ExpressionBacterialPromoterProD, nTETO, and pBAD /AraCAvailable sinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBac(3xP3-gTc’v; Tc-hsp68:Cre)
Plasmid#119063PurposeExpression of Cre recombinase in Tribolium castaneumDepositorInsertspBacL
Tc-hsp68 Promoter
Cre recombinase
Tc-hsp68 3'UTR
SV40polyA
Tc-vermilion
3xP3 TATA
pBacR
ExpressionInsectAvailable sinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Pdx1 neo (DM#237)
Plasmid#15084DepositorInsertPdx1 promoter (Pdx1 Mouse)
ExpressionBacterialAvailable sinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6M
Plasmid#137120PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND NOT FlpDepositorHas serviceAAV8InsertCon/Foff 2.0-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLVX-TetOne-Puro-PSMD4
Plasmid#202666PurposeTet-ON 3rd generation expression vector with inducible expression of PSMD4 and a puromycin selection cassetteDepositorInsertproteasome 26S subunit ubiquitin receptor, non-ATPase 4 (PSMD4 Human)
UseLentiviralExpressionMammalianAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_535-1102 USP7
Plasmid#131246PurposeMammalian expression of the five USP7 UBL domains with an N-terminal Myc tag.DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationExpresses USP7 amino acids 535-1102. This truncat…Available sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only