We narrowed to 1,767 results for: zan
-
Plasmid#225443PurposeGeminino 2.0-no ATG on CDS. BeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1.DepositorInsertBeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_o1_LIR-2nd intron-3'eGFP-T35S-SIR-p35S-5'eGFP-1st intron-LIR (GB5177)
Plasmid#225442PurposeBeYDV LIR:2nd intron + 3'eGFP +T35S:BeYDV SIR + p35S + 5'eGFP + 1st intron:BeYDV LIR for INPACT configuration.DepositorInsertLIR:2nd intron:3'eGFP:T35S:SIR:p35S:5'eGFP:1st intron:LIR
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIH FRB-BFP
Plasmid#202425PurposeTagBFP FKBP-rapamycin binding (FRB) dimerization domainDepositorInsertFKBP-rapamycin binding (FRB) dimerization domain
UseLentiviralTagsTagBFPAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
Tags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
T7pr-His6-MBP-TEV-Cas9-BirA*
Plasmid#159993PurposeBacterial expression of Cas9-BirA*DepositorInsertCas9-BirA*
Tags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
FB026
Plasmid#119711PurposeTranscriptional Unit (TU) for YFP expression, obtained by combining FB/GBparts FB007+GB0053+FB008 into pDGB3alpha1R. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPromoter gpdA:YFP coding sequence:Terminator trpC
UseSynthetic BiologyAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCherry.90 alpha
Plasmid#108222PurposeMammalian expression vector for mCherry fusion to human Hsp90 alphaDepositorAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV_R-PTEN
Plasmid#227433PurposeExpresses the R-PTEN sensor under a CMV promoterDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG) matched positive control in pTwist-CMV
Plasmid#216156PurposeExpresses mScarlet regardless of TDP-43 knockdown. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-20nmEML-mRFP
Plasmid#231181PurposeExpresses a synthetic linker, tagged with mRFP, stabilizing the ER-mitochondrial distance at 20 nm from a lentiviral vectorDepositorInsert20nmEML-mRFP
UseLentiviralPromoterCMVAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-30nmEML-mRFP
Plasmid#231182PurposeExpresses a synthetic linker, tagged with mRFP, stabilizing the ER-mitochondrial distance at 30 nm from a lentiviral vectorDepositorInsert30nmEML-mRFP
UseLentiviralPromoterCMVAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe K-Ras 12V
Plasmid#12544DepositorInsertK-Ras 12V (KRAS Human)
UseRetroviralExpressionMammalianMutation12V constituitively activatedAvailable SinceSept. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-IKBalpha-mut (super repressor)
Plasmid#15291DepositorInsertinhibitor of Kappa B alpha (NFKBIA Human)
UseRetroviralExpressionMammalianMutationS32A/S36A: “super-repressor” allele (resistant to…Available SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBabe-GFP-IKBalpha-mut (super repressor)
Plasmid#15264DepositorInsertIKB alpha (NFKBIA Human)
UseRetroviralExpressionMammalianMutationSerine 32 to Alanine, Serine 36 to AlanineAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-EF1a-hCas9IRESneo
Plasmid#67987PurposeMouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassetteDepositorInsertEF1a-hCas9IRESneopA
ExpressionMammalianAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgCTRL
Plasmid#209750PurposeLentiviral transfer plasmid to express Cas9 and a control, non-specific gRNA (does not target any human gene)DepositorInsertCas9
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL A WT
Plasmid#202413PurposeExpression of GFP-tagged PODXL (isoform A) WTDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only