We narrowed to 21,635 results for: cas9
-
Plasmid#169424PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-NL-DHFR-SpCas9
Plasmid#124522PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cellsDepositorInsertNL-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianMutationPromoterCbhAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX165-Sniper-Cas9
Plasmid#140560PurposeExpresses Sniper Cas9 in mammalian cellsDepositorInsertCas9
UseTagsExpressionMutationF539S M763I K890NPromoterAvailable sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-nCas9n-A71
Plasmid#125644Purposemicro-injection of poly-adenylated nCas9n RNADepositorInsertnCas9n
UseRna in vitro transcription vectorTagsExpressionMutationPromoterT3Available sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ANLN_sgRNA
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CibN-dCas9
Plasmid#60551PurposeExpresses CibN-dCas9 in mammalian cellsDepositorInsertCibN-dCas9
UseCRISPRTagsFLAG and SV40 NLSExpressionMammalianMutationinactivating Cas9 mutations D10A and H840APromoterCMVAvailable sinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SauCas9 EMX1-pegRNA
Plasmid#169857PurposeSauCas9 pegRNA for EMX1DepositorInsertSauCas9 EMX1-pegRNA
UseTagsExpressionMammalianMutationPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP HAT
Plasmid#179547Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
SP6-hCas9-Ce-mRNA
Plasmid#47911PurposeIn vitro transcription of a mRNA encoding humanized Cas9 nuclease, with 3' UTRs suitable for germline expression in C. elegans, for doing CRISPR-Cas by RNA injection. Uses SP6 RNA polymerase.DepositorInserthCas9 with C. elegans 5' and 3' UTRs
UseCRISPRTagsExpressionMutationPromoterSP6Available sinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX165-Cas9-HF1
Plasmid#140565PurposeExpresses Cas9-HF1 in mammalian cellsDepositorInsertCas9
UseTagsExpressionMutationN497A R661A Q695A Q926APromoterAvailable sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgCh2-2-Blast
Plasmid#199645PurposeExpresses Cas9 and sgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR2B-dCas9-KRAB
Plasmid#115547PurposeEntry cassette for dCas9-KRABDepositorInsertdCas9-KRAB
UseTagsHAExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9-beta-mmr
Plasmid#169241PurposeCas9, beta, and mutL mutant expression plasmid for introducing chromosomal point mutationsDepositorInsertscas9
beta
mutL-E36K
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationChanged glutamic acid 36 to lysinePromoterAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorInsertECT2 sgRNA spacer (ECT2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-AAVS1_sgRNA
Plasmid#183891PurposepX459V2.0-HypaCas9 plasmid with sgRNA targeting the AAVS1 in human cells.DepositorInsertAAVS1 sgRNA spacer (AAVS1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-CjCas9
Plasmid#107033PurposeAAV plasmid expressing CjCas9 under control of miniCMV promoterDepositorInsertCjCas9
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 PE2*-3HA
Plasmid#169854PurposeMammalian Expression, SpyCas9 PE2* prime editor with 3HA-tagDepositorInsertSpCas9-H840A-star-M-MLV-3HA
UseTags3XHA tag, bpSV40 NLS and SV40 NLS, and cmyc-NLS a…ExpressionMammalianMutationPromotercmvAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only