We narrowed to 11,024 results for: cat.1
-
Plasmid#145783PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and E45A mutation in capsid (CA E45A).DepositorInsertCapsid
UseLentiviral and RetroviralExpressionMammalianMutationChanged Capsid residue glutamic acid 45 to alanin…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA M66I
Plasmid#149687PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and M66I mutation in capsid (CA M66I).DepositorInsertCapsid
UseLentiviral and RetroviralExpressionMammalianMutationChanged Capsid residue Met 66 to Iso (CA M66I)Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1-Rfc3-T76D
Plasmid#175051PurposeOverexpression of human Rfc2,Rfc3-3KtoA,Rfc4,Rfc5 in E.coliDepositorExpressionBacterialMutationchanged Thr76 to Asp, phosphomimetic mutationPromoterT7 promoterAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1-Rfc3-3KtoA
Plasmid#175050PurposeOverexpression of human Rfc2,Rfc3-3KtoA,Rfc4,Rfc5 in E.coliDepositorExpressionBacterialPromoterT7 promoterAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-Dual_BNIP3(1-158aa)-THROMBIN-GST (W18A/L21A; deltaLIR)
Plasmid#223778PurposeExpression of recombinant protein for purificationDepositorInsertBNIP3 soluble part (BNIP3 Human)
TagsThrombin cleavage-GSTExpressionInsectMutationW18A/L21A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (I224A/L227A; deltaLIR3)
Plasmid#223775PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationI224A/L227A; deletion of LIR3Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (I307A/V310A; deltaLIR4)
Plasmid#223776PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationI307A/V310A; deletion of LIR4Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (Y213A/I216A; deltaLIR2)
Plasmid#223783PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationY213A/I216A; deletion of LIR2Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (W276A/I279A; deltaLIR1)
Plasmid#223746PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationW276A/I279A; deletion of LIR1Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_NIX(1-182aa)-EGFP-TEV-GST (W36A/L39A; deltaLIR)
Plasmid#223748PurposeExpression of recombinant protein for purificationDepositorInsertNIX (BNIP3L) soluble part (BNIP3L Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationW36A/L39A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_FUNDC1(1-50aa)-EGFP-TEV-GST (Y18A/L21A; deltaLIR)
Plasmid#223750PurposeExpression of recombinant protein for purificationDepositorInsertFUNDC1 soluble part (FUNDC1 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationexpresses aa 1-50, with Y18A/L21A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)(2) sites mutant pGL3Basic
Plasmid#32734DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) - CTTTGATCTTTGCT deleti…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)-(3) sites mutant pGL3Basic
Plasmid#32735DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)-(4) sites mutant pGL3Basic
Plasmid#32736DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET3a-FruK
Plasmid#186256PurposeOverexpression of FruK for purificationDepositorAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75234PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV RT D185A
Plasmid#145782PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and D185A mutation in reverse transcriptase (RT D185A).DepositorInsertReverse Transcriptase
UseLentiviral and RetroviralExpressionMammalianMutationChanged Reverse Transcriptase Aspartic Acid 185 t…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlc_N + pSiMPlc_C
Plasmid#134312PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertcmR_gp41-1 N-intein + cmR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only