We narrowed to 6,945 results for: lentiviral plasmid
-
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralTagsExpressionMutationPromoterEFS-NSAvailable sinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralTagsExpressionMutationPromoterEFS-NSAvailable sinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PWPXLD-EGFR-P667A
Plasmid#133750PurposeEGFR with mutation at proline 667 converted to alanine and tagged with HA cloned into PWPXLD plasmidDepositorInsertMutant P667A EGFR-HA (EGFR Human)
UseLentiviralTagsHA tagExpressionMammalianMutationproline 667 converted to alanine (Please see depo…PromoterEF1-alphaAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh2
Plasmid#132710PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Crh geneDepositorInsertshCrh(2) (Crh Rat)
UseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA802: pMVP (L3-L2) AID + WPRE
Plasmid#121794PurposepMVP L3-L2 entry plasmid, contains AID + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of minimal C-term AID domain (activated by auxin) to gene in lentivirus vectorsDepositorInsertAID + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBOBI-FLuc
Plasmid#170674PurposeExpress firefly luciferase. Used in lentivirus-based SARS-CoV-2 related (MERS) pseudovirus assay.DepositorInsertluc
UseLentiviral and LuciferaseTagsExpressionMammalianMutationPromoterCMV-FAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-RFP
Plasmid#22910DepositorInsertChicken Beta-actin promoter driving DsRedExpress
UseAAV; Adeno-associated virusTagsExpressionMammalianMutationPromoterAvailable sinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA601: pMVP (L3-L2) P2A-Puro + WPRE
Plasmid#121785PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Puro + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only