We narrowed to 4,733 results for: GCA
-
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
shTCF7L2 # 1
Plasmid#42557DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBa.Lamp1-GFP
Plasmid#180250PurposeMammalian expression of LAMP1DepositorAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_1
Plasmid#74180Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pResQ shDna2'
Plasmid#31952DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shGFP
Plasmid#83085PurposeLentiviral shRNA vector for inducible knockdown of GFP (control hairpin)DepositorInsertshGFP
UseLentiviralExpressionMammalianAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-miR-34 MT
Plasmid#78259PurposepsiCHECK2 dual luciferase reporter harboring a mutated miR-34 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertmutated miR-34 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CCGT to GG…Available SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_ASCL1
Plasmid#64131PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-BNT162b2ΔUTR
Plasmid#171214PurposeGateway entry vector containing the BNT162b2/tozinameran cDNA sequence lacking the original 5' and 3' UTRs and the poly(A) tail. The original Kozak sequence has also been altered.DepositorInsertBNT162b2ΔUTR
UseGateway CloningMutationKozak sequence changed from CCCGCCACC to GGCTGCAC…Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_TRAC
Plasmid#164993PurposeExpression of gRNA targeting TCRalpha constant locusDepositorInsertgRNA against TRAC
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgMTHFD2_1
Plasmid#106313PurposeExpress Cas9 and sgRNA targeting MTHFD2DepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgCIC-1
Plasmid#74966PurposesgCIC-1, puromycin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_2
Plasmid#36336DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
61426-hU6-shmFmr1-EF1a-mCherry
Plasmid#157859PurposeExpresses a shRNA targeting mouse Fmr1 geneDepositorAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
shMEK1/2 puro
Plasmid#72567PurposeHairpin targeting MEK1 and MEK2 (murine).DepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUGW-H1-Syndecan-1 shRNA (ORF)
Plasmid#40622DepositorInsertSyndecan-1 shRNA(ORF) (Sdc1 Mouse)
UseLentiviral and RNAiAvailable SinceOct. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-HDAC1-shRNA3
Plasmid#90243PurposeLentivirus for expression of shRNA3 against human HDAC1 (Dox-inducible)DepositorInsertHDAC1 (HDAC1 Human)
UseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only