We narrowed to 6,266 results for: GCA
-
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry-intergenic-As
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_BRF2 (pAVA3258)
Plasmid#239326PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting BRF2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting BRF2 (BRF2 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
DGKE gRNA (BRDN0001147022)
Plasmid#76609Purpose3rd generation lentiviral gRNA plasmid targeting human DGKEDepositorInsertDGKE (DGKE Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-spsgRNA2
Plasmid#64114PurposeVector for expression of Sp sgRNA2 in mammalian cellsDepositorInsertSp sgRNA2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
UseTagsExpressionMutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and ā¦PromoterAvailable sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Alk.2 shRNA
Plasmid#59297PurposeshRNA to mouse AlkDepositorInsertAlk.2 shRNA
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromotermouse U6Available sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD hCPS1 AD
Plasmid#188130PurposeExpresses C-terminal flag-tagged human CAD hCPS1 AD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimiā¦PromoterAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shPIK3CD.v1 puro
Plasmid#58706PurposeLentiviral shRNA vector for knockdown of human PIK3CDDepositorInsertshPIK3CD (PIK3CD Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralTagsExpressionMammalianMutationPromoterH1Available sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ai162 (TIT2L-GC6s-ICL-tTA2) targeting vector
Plasmid#114433PurposeTarget a Cre-dependent GCaMP6s cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6s, tTA2
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector
Plasmid#114428PurposeTarget a Cre-dependent GCaMP6f expression and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6f
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only