We narrowed to 1,605 results for: N-pac
-
Plasmid#196679PurposeRep/Cap plasmid for the production of MDV1A, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRSVGSVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP-S100A10
Plasmid#107200PurposeExpresses YFP-human S100A10 fusion protein for live cell imagingDepositorAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1C
Plasmid#196685PurposeRep/Cap plasmid for the production of PAL1C, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1D
Plasmid#196686PurposeRep/Cap plasmid for the production of PAL1D, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTFR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1B
Plasmid#196684PurposeRep/Cap plasmid for the production of PAL1B, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPSQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1A
Plasmid#196683PurposeRep/Cap plasmid for the production of PAL1A, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKD284
Plasmid#125073PurposeExpression of SO_4488 under PtacDepositorUseSynthetic BiologyExpressionBacterialAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKD278
Plasmid#125070PurposeExpression of SO_2192 under PtacDepositorUseSynthetic BiologyExpressionBacterialMutationMutation in LacI S286L- Please see depositor comm…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRS306:VN
Plasmid#37555DepositorInsertVenus N-term (aa 1-272)
ExpressionBacterialAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET28b-BE1
Plasmid#73018PurposeExpresses BE1 with N-terminal His6 tag in E. ColiDepositorInsertBE1
TagsHis6 tagExpressionBacterialPromoterT7Available SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB6N_RB38-Mt-tk_v8_AGKS
Plasmid#191514PurposeExpression of mitochondrial v8 ZF-DdCBE in mammalian cells (N-terminal DddAN, Right)DepositorInsertv8 ZF-DdCBE RB38-Mt-tk AGKS
ExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB7N_LT51-Mt-tk_v8_AGKS
Plasmid#191515PurposeExpression of mitochondrial v8 ZF-DdCBE in mammalian cells (N-terminal DddAC, Left)DepositorInsertv8 ZF-DdCBE LT51-Mt-tk AGKS
ExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.S
Plasmid#103006Purposenon-standard AAV2 rep-AAV-PHP.S cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.S VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.eB
Plasmid#103005Purposenon-standard AAV2 rep-AAV-PHP.eB cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.eB VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLpA-DN.JNK1
Plasmid#51942PurposeAdenoviral vector for dominant negative JNK1 expressionDepositorInsertDN JNK1 (Mapk8 Mouse)
UseAdenoviralTagsFLAGMutationdominant negative: the dual phosphorylation moti…PromoterCMVAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
tetO-MEF2C
Plasmid#46031DepositorAvailable SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLpA-DN.JNK2
Plasmid#51943PurposeAdenoviral vector for dominant negative JNK2 expressionDepositorInsertDN JNK2 (Mapk9 Mouse)
UseAdenoviralTagsHAMutationdominant negative: the dual phosphorylation moti…PromoterCMVAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only