We narrowed to 3,228 results for: Streptococcus
-
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-Crispr-V2-HMID.v1
Plasmid#103062PurposeLentiCrisprV2 with guide targeting V1-V5 GESTALT barcodesDepositorInsertCas9 plus expressed GESTALT V1-V5 guide
UseLentiviralAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN052
Plasmid#220046PurposeMammalian expression of type III-A Csm complex from Streptococcus thermophilus without NLS tagsDepositorInsertFLAG-Csm1; FLAG-Csm2; FLAG-Csm3; FLAG-Csm4; FLAG-Csm5; FLAG-Cas6; crRNA; GFP
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN099
Plasmid#220044PurposeMammalian expression of type III-A crRNA from Streptococcus thermophilusDepositorInsertcrRNA
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA pool for Streptococcus pneumoniae
Pooled Library#170432PurposeConcise library targeting the whole genome of S. pneumoniae D39V with one sgRNA per operon or gene.DepositorExpressionBacterialUseCRISPRAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-spCas9 ABE-Umax
Plasmid#222138PurposeAdenine base editor with modified TadA variant for A-to-G base editing in zebrafishDepositorInsertModified TadA-nSpCas9 (cas9 Synthetic)
UseCRISPR; Zebrafish expressionTagsbipartite NLSPromoterT3Available SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAEL006511-Cas9
Plasmid#100580PurposeThe promoter of AAEL006511 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL006511-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL006511 and Opie2Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9
Plasmid#237461PurposeTransfection-based all-in-one base editor plasmid that expresses both cytosine base editor (evoCDA1-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_evoCDA1_ssDBD_nickase SpCas9 _6xUGI
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
SpRY-Tad-CBE(ACC2)
Plasmid#235081PurposeExpresses SpRY-Tad-CBE(ACC2) in mammalian cells.DepositorInsertTad-CBE(ACC2)-SpRY Cas9 D10A
UseCRISPRTags2xUGI, bpNLS and bpNLSExpressionMammalianAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#2-puro
Plasmid#231980PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#1-puro
Plasmid#231979PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX379 Legionella pneumophila str. Paris Cas9
Plasmid#68316PurposeLegionella pneumophila str. Paris Cas9DepositorInsertLpCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX391 Sphaerochaeta globus str. Buddy Cas9
Plasmid#68328PurposeSphaerochaeta globus str. Buddy Cas9DepositorInsertSgCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA1
Plasmid#133340Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the non-template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pS848∙CsR
Plasmid#199240PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAEL007097-Cas9
Plasmid#100705PurposeThe promoter of AAEL007097 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL007097-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL007097 and Opie2Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN053
Plasmid#220047PurposeMammalian expression of type III-A crRNA from Streptococcus thermophilus within 5`UTR of mCherry transcriptDepositorInsertcrRNA-mCherry
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN102
Plasmid#220045PurposeMammalian expression of type III-A crRNA and Cas6 crRNA-processing ribonuclease from Streptococcus thermophilusDepositorInsertcrRNA; Cas6
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only