We narrowed to 20,741 results for: RAN-1
-
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CMV-GFP-pA U6 shRNA (Rat Nurr1 #1)
Plasmid#233273PurposeTo express GFP from a CMV promoter and to express an shRNA targeting Rat Nurr1DepositorInsertGFP and shRNA targeting Rat Nurr1 (Nr4a2 Rat)
UseAAVAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[closed]
Plasmid#71810PurposeGenerating transgenic flies for FLP-inducible DamIDDepositorInsertmin.hsp70P-FRT-STOP#1-FRT-Dam-Myc[closed]
ExpressionInsectAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[open]
Plasmid#71809PurposeGenerating transgenic flies for FLP-inducible DamIDDepositorInsertmin.hsp70P-FRT-STOP#1-FRT-Dam-Myc[open]
ExpressionInsectAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS1354 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-1 CMV-BFP
Plasmid#226113PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-1-5p Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Gattinara in pRDA_118 backbone
Pooled Library#136986PurposeDesigned for assays with limited cell numbers with 2 guides per gene. Compatible with John Doench’s Brunello human genome-wide library.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Gouda in pRDA_118 backbone
Pooled Library#136987PurposeDesigned for assays with limited cell numbers with 2 guides per gene. Compatible with John Doench’s Brie mouse genome-wide library.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-pA U6 shRNA (Rat NPAS4 #1)
Plasmid#233270PurposeTo express GFP from a CMV promoter and to express and shRNA targeting Rat Npas4DepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K12(1)-U6-sgMap3K12(2)-hSyn1-mCherry
Plasmid#208835PurposeKnockout of Map3K12 (DLK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K13(1)-U6-sgMap3K13(2)-hSyn1-mCherry
Plasmid#208836PurposeKnockout of Map3K13 (LZK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB80-hsKIF5B(1-560)Rigor-L-2xHA-L-FRB
Plasmid#193719PurposeRapalog-inducible coupling to dimeric human kinesin-1 (KIF5B aa1-560) via FKBP for anterograde transportDepositorInserthsKIF5B(1-560)Rigor-L-2xHA-L-FRB (KIF5B Human, Synthetic)
Tags2xHA-FRBExpressionMammalianMutationhsKIF5B(aa1-560), RIGOR: G234APromoterChicken beta-actinAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSM041-3 SFFV-mCherry-SGc(stem-1(3xPP7))cSG-EGFP
Plasmid#233408PurposeLIDAR reporter RNA with PCP binding site instead of MCP; mCherry as marker, EGFP as outputDepositorInsertmCherry-SGc(stem-1(3xPP7))cSG-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
XZ392 SFFV-secNLuc-SGc(stem-1(3xMS2))cSG(tight)-ssSEAP
Plasmid#233415PurposeLIDAR reporter RNA; secreted NanoLuc Luciferase as marker, SEAP as outputDepositorInsertsecNLuc-SGc(stem-1(3xMS2))cSG(tight)-ssSEAP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LSM053 SFFV-mCherry-SGc(stem-1(3xPP7))cSG-mtagBFP (FLP-IN)
Plasmid#233409PurposeLIDAR reporter RNA with PCP binding site instead of MCP; mCherry as marker, mTagBFP as outputDepositorInsertmCherry-SGc(stem-1(3xPP7))cSG-mtagBFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2211 - [1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
Plasmid#159866PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1972 - [1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
Plasmid#159844PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only