We narrowed to 15,974 results for: grna
-
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only
-
CAN1 gRNA HIS
Plasmid#182521PurposeExpression vector for gRNA directed against CAN1 ORF.DepositorInsertCAN1 gRNA (CAN1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOC1 Halo-Actb KI
Plasmid#183426PurposeCreON knock-in for Halo-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and Halo donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE834
Plasmid#231168PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-NT-1mer-gRNA
Plasmid#227500Purposenon-targeting control guideDepositorInsertNon-targeting gRNA
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-1
Plasmid#164865PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-1
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_1
Plasmid#86346PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) ACTB
Plasmid#74705PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of ACTB mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNA
UseCRISPRExpressionMammalianAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PasCas13b-gRNA-EGFP(W58stop)
Plasmid#180507PurposePasCas13b-gRNA targeting EGFP(W58stop) for RNA editingDepositorInsertPasCas13b-gRNA targeting EGFP(W58stop)
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PasCas13b-gRNA-Nluc(W12stop)
Plasmid#180506PurposePasCas13b-gRNA targeting Nluc(W12stop) for RNA editingDepositorInsertPasCas13b-gRNA targeting Nluc(W12stop)
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7mitfagRNA
Plasmid#47931Purposein vitro transcription of mitfa gRNADepositorInsertmitfa gRNA (mitfa Zebrafish)
UseCRISPRAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A6-gRNA_(CJT88)
Plasmid#226987PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A6)DepositorInsertSpCas9 gRNA A6 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A7-gRNA_(CJT89)
Plasmid#226986PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A7)DepositorInsertSpCas9 gRNA A7 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only