We narrowed to 4,550 results for: 187
-
Plasmid#114187Purposestudying clustering of Beta2 receptors by superresolution microscopy (PALM)DepositorInsertAdrenergic receptor beta 2 (ADRB2 Human)
Tags3HA, FLAG, and mEOS2ExpressionMammalianPromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-IFT27
Plasmid#218722PurposeExpresses N-terminally EGFP-tagged IFT27 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-V5-PTPN14-del-C
Plasmid#61005PurposeExpresses human PTPN14 (del-phosphotase domain mutant) in mammalian cells, N-terminus V5 tagDepositorInsertPTPN14 delete C (PTPN14 Human)
TagsV5 tagExpressionMammalianMutationdeleted amino acids 934-1187PromoterCMVAvailable SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-1
Plasmid#181870PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTER E2F2shRNA human
Plasmid#66884PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F2DepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pONSY-CoNMM:mCherry
Plasmid#111878PurposeThis plasmid expresses mCherry fluorescent protein fused to an N-Myristoylation motif (NMM) from the endogenous Src2 gene (CAOG_06360). It can be used to visualize the membrane and filopodia.DepositorInsertCapsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry
UseCapsaspora owczarzakiTagsmCherryPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_EIF3D_sgRNA_1
Plasmid#74187Purposelentiviral vector expressing sgRNA targeting EIF3DDepositorInsertEIF3D sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
F2RL2-bio-His
Plasmid#51877PurposeExpresses full-length Proteinase-activated receptor 3 ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertF2RL2 (F2RL2 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4.TO-ORF27-2xCSTREP
Plasmid#136187PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) ORF27DepositorInsertORF27
ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTER E2F3shRNA human
Plasmid#66885PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F3DepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Pcdh15_mini_V8-CD2
Plasmid#199187PurposeAn AAV plasmid designed to facilitate the expression of mini-PCDH15 in the inner ear of a mouse.DepositorInsertmmPcdh15_mini_V8-CD2
UseAAVMutationEC5, EC6, EC8, EC9, EC10 are deleted from msPCDH1…Available SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pONSY-CoH2B:Venus
Plasmid#111877PurposeThis plasmid expresses Venus fluorescent protein fused to endogenous Histone H2B (H2B) gene of Capsaspora (CAOG_01818). It can be used to transfect Capsaspora cells and visualize nucleus in vivo.DepositorInsertCapsaspora Histone H2B (CoH2B) fused to Venus
UseCapsaspora owczarzakiTagsVenusPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMIR-31-Reporter
Plasmid#71871PurposeMammalian expression vector for the analysis of miR-31 activityDepositorInsertReverse complementary sequence of miR-31
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAPBPL pEGFP-C3 (1765)
Plasmid#62055Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP TEM4 DEL NTERM
Plasmid#58894PurposeExpresses GFP tagged TEM4 with N terminus deletedDepositorInsertTEM4 (ARHGEF17 Human)
TagsEGFPExpressionMammalianMutationDeleted N Terminus up to aa 1002PromoterCMVAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.5-Fc-His
Plasmid#72102PurposeExpresses the extracellular region of the Neuropilin 2, isoform 5 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAH-MIBP16
Plasmid#51870PurposeExpresses C-terminal HA-tagged full length rat MIBP1 (cloned into pCAGGS)DepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.1-AP-His
Plasmid#71972PurposeExpresses the extracellular region of the Neuropilin 2, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only