163,774 results
-
Plasmid#176016PurposeMammalian expression of mCherry. Parton lab clone DFQDepositorInsertmCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-dCas9-KRAB-blast
Plasmid#89567PurposePlasmid expression dCas9 protein in fusion with KRAB domainDepositorInsertdCas9
UseLentiviralTagsBlasticidin resistance gene and KRABExpressionMutationD10A and H840APromoterAvailable sinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Soma-jGCaMP8m (AAV9)
Viral Prep#169257-AAV9PurposeReady-to-use AAV9 particles produced from AAV-hSyn-Soma-jGCaMP8m (#169257). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8m plasmid DNA. Syn-driven expression of soma-targeted calcium sensor jGCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTagsNoneAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AID-PcrA M6-UGI-T2A-mTagBFP2
Plasmid#221225PurposeExpress HACE Editor as a fusion of AID cytidine deaminase and an optimized PcrA M6 helicase with mTagBFP2 reporterDepositorInsertAID-PcrA M6-UGI-T2A-mTagBFP2
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ApoE3
Plasmid#197147PurposeExpresses ApoE3 in Mammalian cellDepositorInsertApoE3 (APOE Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-protein1-IRES-protein2-IRESatt-EGFP-2A-PuroR-SMAR-g5
Plasmid#208377PurposeEpisomal plasmid for expression of 2 proteins with puromycin selection and EGFP monitoringDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterhuman CMVAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRPML1-G-GECO1.2-ERES
Plasmid#207144PurposeFusion of Ca2+ reporter and lysosomal Ca2+-permeable channel, with ER-export signalDepositorInsertMcoln1 (MCOLN1 Human)
UseTagsER-Export Signal (ERES) and G-GECO1.2ExpressionMammalianMutationPromoterCMVAvailable sinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-MCS--4x6T-WPRE
Plasmid#196417PurposeEmpty vector for astrocyte-selective expression in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorTypeEmpty backboneUseAAV; Astrocyte-selectiveTagsExpressionMammalianMutationPromoterGfaABC1DAvailable sinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-BFP (AAV8)
Viral Prep#137130-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Foff 2.0-BFP (#137130). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Foff 2.0-BFP plasmid DNA. EF1a-driven, Cre-dependent expression of BFP (inhibited in the presence of Flp recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsBFP (Cre-dependent)Available sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only