We narrowed to 4,724 results for: GCA
-
-
pSC39
Plasmid#104813PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101180 (Cop-like). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr2g101180
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC24
Plasmid#104798PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101120, Medtr2g101130 (Acre2). Also expresses Cas9 from rolD promoter from AtUBQ10 promoterDepositorInsertMedtr2g101120, Medtr2g101130
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDY2262 hACTB atgRNA Paired Guide 2
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
T-STOP sgRNA-1
Plasmid#83346PurposeThe sgRNA at the stop codon of human Brachyury(T) locusDepositorInsertT-STOP sgRNA
ExpressionMammalianPromoterU6Available SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDY2259 hNOLC1 atgRNA Paired Guide 1
Plasmid#220989PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2260 hNOLC1 atgRNA Paired Guide 2
Plasmid#220990PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shSOD1
Plasmid#102975PurposeSuppression of SOD1DepositorInsertshSOD1 (SOD1 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGPTVII-Bar-U-MatryoshCaMP6s
Plasmid#100024PurposePlant expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting cpEGFP.DepositorInsertMatryoshCaMP6s
ExpressionPlantPromoterAtUBQ10Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST
Plasmid#125689PurposeC to T base editor for actinomycetesDepositorInsertstreptomyces codon optimized spCas9n (D10A), modified sgRNA casette, streptomyces codon optimized rAPOBEC1
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-shEsr1
Plasmid#120720PurposeLentiviral vector that expresses GFP and an shRNA targeting Esr1 (in pLL3.7).DepositorInsertEsr1 shRNA (Esr1 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianPromoterMouse U6Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_cmlc2(myl7)_cmlc2-nmKate
Plasmid#238374PurposeDrives expression of 3 different gRNAs targeting cmlc2 (myl7), and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting cmlc2
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-AviTag-DogTag-MBP
Plasmid#171773PurposeExpresses AviTag-DogTag-Maltose binding protein in bacterial cytoplasm. The AviTag enables site-specific biotinylation by BirA.DepositorInsertAviTag-DogTag-MBP
TagsHis6 and Thrombin cleavage siteExpressionBacterialMutationPeptide tag added to N-terminus of MBP via a GSGE…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_ect2_cmlc2-nmKate
Plasmid#238410PurposeDrives expression of 3 different gRNAs targeting ect2, and expression of nuclear mKate in cardiomyocytesDepositorInsertnuclear mKate/3 gRNAs targeting ect2
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-DEST-MatryoshCaMP6s
Plasmid#100025PurposeMammalian expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting cpEGFP.DepositorInsertMatryoshCaMP6s
TagsV5 Epitope TagExpressionMammalianPromoterCMVAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-31-murderous_crow
Plasmid#138985PurposeIVT template for the alpha subunit of the mouse TCR #31 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-30-picky_sticky
Plasmid#138984PurposeIVT template for the beta subunit of the mouse TCR #30 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only