We narrowed to 1,730 results for: Tyr
-
Plasmid#170537PurposeExpresses PTPIP51 FFAT-like motif (151-175) deletion mutant (1-150_176-470) in human HeLa cells after transfectionDepositorInsertProtein tyrosine phosphatase interacting protein 51 (RMDN3 Human)
TagsFLAG tagExpressionMammalianMutationdeleted amino acids 151-175PromoterCAG promoterAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-EphB3-SV40-GFP (B3G)
Plasmid#65443PurposeExpression of EPHB3 and GFP in mammalian cellsDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgGabbr1
Plasmid#240044PurposeKnockdown expression of Gabbr1DepositorInsertgamma-aminobutyric acid type B receptor subunit 1 (Gabbr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterCMVAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A(K188R)-2A-mCherry
Plasmid#177166PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Lysine at position 188 substituted with Arginine.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationChanged Lysine 188 to ArgininePromoterCMV with beta globin intronAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF6-Lck-TurboID
Plasmid#159433Purposeexpresses Lck-TurboID in mammalian cellsDepositorInsertsTagsHAExpressionMammalianMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…PromoterEF-1aAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 ALPK1 Y254C
Plasmid#231587PurposeALPK1 gene mutated in position Y254C (Pathogenic mutation in ROSAH syndrome) under control of a doxycycline-inducible promoterDepositorInsertALPK1 (ALPK1 Human)
UseLentiviralTags3X flagExpressionMammalianMutationchanged tyrosine 254 to cysteinePromoterdoxycyclineAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GABBR1-DuET
Plasmid#213247PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB-NLS_T2A_EGFP (Y67X)_LNMA intron
Plasmid#246435PurposeExpresses inactive EGFP (Y67X) in mammalian cells for trans-splicing assessments. LMNA intron is inserted into EGFP CDS.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID
EGFP
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cAbl
Plasmid#214234PurposeBacterial expression of the kinase domain of cAbl with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRaGE Pyl TAG GFP Y35TAG
Plasmid#160041PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.DepositorInsertsPyrrolysyl tRNA synthetase (Methanosarcina mazei)
Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
deGFP
UseSynthetic BiologyTagsHis-tagExpressionBacterialMutationChanged tyrosine 35 to TAG stop-codon (Site numbe…PromoterP70b promoter and T500 terminator, Vibrio natrieg…Available SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-EphB4-SV40-GFP (B4G)
Plasmid#65444PurposeExpression of human EPHB4 and GFP in mammalian cellsDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKM-U6-reRNA-hsHEKsite_1_3
Plasmid#205638PurposereRNA guide targeting HEKsite_1_3DepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116
Plasmid#123243PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterPGKAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-ISG15 C78SN13Y
Plasmid#165106Purposebacterial expressio of a GST fusion of Human ISG15 C78SN13YDepositorInsertISG15 (ISG15 Human)
TagsGST from plasmid.ExpressionBacterialMutationC78SN13Y; The sequence of ISG15-C78S/N13Y contai…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
MERTK_HUMAN_D0
Plasmid#79705PurposeThis plasmid encodes the kinase domain of MERTK. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EphrinB3-Flag(A227Y)
Plasmid#155013PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EphrinB3 A227Y variant from pcDNA3.1DepositorInsertEphrinB3 (EPHB3 Human)
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationA227YPromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
EPHB4-2A-EGFP
Plasmid#139968PurposeDonor vector to knockin EGFP (separated by 2A) into EPHB4 alleleDepositorInsertHuman EPHB4 knockin homology arms (EPHB4 Human)
ExpressionMammalianAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-Y766F
Plasmid#59777PurposeExpresses optoFGFR1 with mutation in PLC-gamma binding phosphotyrosine site of FGFR1DepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116A
Plasmid#123245PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116A. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationGlycine 116 to AlaninePromoterPGKAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only