We narrowed to 184 results for: GCaMP6f
-
Plasmid#127872PurposeDual expression vector for mitochondrial matrix and outer membrane Ca2+ sensorsDepositorInsertOuter membrane localized jRCaMP1b - P2A - mito4xGCaMP6f
ExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV_Xph15-GCaMP6f
Plasmid#135538PurposeEncodes a specific PSD-95 binder (Xph15) fused to GCaMP6fDepositorInsertXph15
TagsGCaMP6fExpressionMammalianPromoterCMVAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV1)
Viral Prep#83899-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-GCaMP6F (AAV5)
Viral Prep#137122-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-Con/Fon-GCaMP6F (#137122). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Fon-GCaMP6F plasmid DNA. EF1a-driven, Cre and Flp-dependent expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA (AAV1)
Viral Prep#68719-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA (#68719). In addition to the viral particles, you will also receive purified pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor with bicistronic mRuby2. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAG-FLEXTagsmRuby2 (Cre-dependent)Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-GCaMP6F (AAV8)
Viral Prep#137122-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Fon-GCaMP6F (#137122). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Fon-GCaMP6F plasmid DNA. EF1a-driven, Cre and Flp-dependent expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f (AAV1)
Viral Prep#135632-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-S5E2-GCaMP6f (#135632). In addition to the viral particles, you will also receive purified pAAV-S5E2-GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-GCaMP6F (AAV8)
Viral Prep#137124-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Coff/Fon-GCaMP6F (#137124). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Coff/Fon-GCaMP6F plasmid DNA. EF1a-driven, Flp-dependent expression of GCaMP6f (inhibited in presence of Cre). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
sspa-GCaMP6m
Plasmid#67560Purposeshort photoactivatable fluorescent calcium reporterDepositorInsertsspa-GCaMP6m
ExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f (AAV9)
Viral Prep#135632-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-S5E2-GCaMP6f (#135632). In addition to the viral particles, you will also receive purified pAAV-S5E2-GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV Cag Flex H2B Gcamp6f reverse
Plasmid#74155PurposeCalcium SensorDepositorInsertGcamp6f
UseAAVTagsH2BPromoterCAGAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV Synapsin Intron H2B Gcamp 6f wpre Pzac2.1
Plasmid#74144PurposeCalcium sensorDepositorInsertGCaMP6f
UseAAVTagsH2BPromotersynapsinAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-Drosophila-Letm1
Plasmid#212663PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and Drosophila-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SomaGCaMP6f2 (AAV8)
Viral Prep#158757-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-CAG-SomaGCaMP6f2 (#158757). In addition to the viral particles, you will also receive purified pAAV-CAG-SomaGCaMP6f2 plasmid DNA. CAG-driven expression of soma-targeting GCaMP6f2. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAG promoterAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SomaGCaMP6f2 (AAV9)
Viral Prep#158757-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-SomaGCaMP6f2 (#158757). In addition to the viral particles, you will also receive purified pAAV-CAG-SomaGCaMP6f2 plasmid DNA. CAG-driven expression of soma-targeting GCaMP6f2. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAG promoterAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Phi3-GCaMP6f
Plasmid#106298PurposeCMV driven GFP based calcium (Ca2+) reporterDepositorInsertGCaMP6f
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ai95(RCL-GCaMP6f) targeting vector
Plasmid#61579PurposeTarget a Cre-dependent GCaMP6-fast expression cassette to the mouse Rosa26 locusDepositorInsertCAG-LSL-GCaMP6-fast
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-GCaMP6f (AAV1)
Viral Prep#112000-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSynapsin1-axon-GCaMP6f (#112000). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-GCaMP6f plasmid DNA. Synapsin-driven, axon-targeted GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only