We narrowed to 4,522 results for: ARA-2
-
Plasmid#70270PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Gata3DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-FLAG-HA-CAD S1859A
Plasmid#46239PurposeFLAG-HA-CAD with S1859 phosphorylation site mutated to alanineDepositorInsertcarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad Mouse)
TagsFLAG and HAExpressionMammalianMutationSerine 1859 changed to Alanine (S1859A)PromotercmvAvailable SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFRT/FLAG/HA-DEST EIF2C2
Plasmid#19888DepositorInsertEukaryotic translation initiation factor 2C, 2 (AGO2 Human)
TagsFLAG/HAExpressionMammalianAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAC95-pmax-dCas9VP160-2A-neo
Plasmid#48227PurposedCas9VP160-2A-neo (neo/G418-selectable) on pmax expression vector. Note: This is being tested.DepositorInsertdCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo
UseCRISPRTags2A-neo, HA Tag, and VP160ExpressionMammalianMutationD10A;H840A (catalytically inactive)PromoterCAGGSAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN186
Plasmid#91573PurposeExpress sgRNA targeting human AKT3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN187
Plasmid#91574PurposeExpress sgRNA targeting human AKT3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1 Slp2-a C2AB
Plasmid#40058DepositorInsertSlp2-a C2AB (Sytl2 Mouse)
TagsGSTExpressionBacterialMutationC2AB domains onlyPromoterTacAvailable SinceNov. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCKC017
Plasmid#226622PurposepLenti wt hTdT template for libraries 1-2DepositorInsertTerminal deoxynucleotidyl transferase (DNTT Human)
UseLentiviral and Synthetic BiologyExpressionMammalianMutationsynonymous mutation in D2, synonymous mutation in…PromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMeCP2Y pc644
Plasmid#167565PurposeThe complete rat MeCp2 ORF is fused in frame of the NH2-terminus of the enhanced YFP (pEYFP-N1 vector; CLONTECH Laboratories, Inc.)DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Dcst2-3xHA
Plasmid#183541PurposeExpress Dcst2-3xHA under the mouse Clgn promoter.DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R254K
Plasmid#104466Purposeexpress MBP hnRNPA2 LC with 2 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C (NT809)
Plasmid#50866PurposeExpresses human NKCC1 P676C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475)
Plasmid#50875PurposeExpresses human NKCC1 I674C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI674C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N680C A734C (NT816)
Plasmid#50870PurposeExpresses human NKCC1 N680C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN680C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L737C (NT523)
Plasmid#50891PurposeExpresses human NKCC1 L737C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationL737C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C A734C (NT810)
Plasmid#50867PurposeExpresses human NKCC1 P676C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N672C (NT474)
Plasmid#50873PurposeExpresses human NKCC1 N672C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN672C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C (NT443)
Plasmid#50877PurposeExpresses human NKCC1 P676C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N731C (NT505)
Plasmid#50885PurposeExpresses human NKCC1 N731C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN731C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 V673C (NT437)
Plasmid#50874PurposeExpresses human NKCC1 V673C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationV673C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I677C (NT467)
Plasmid#50878PurposeExpresses human NKCC1 I677C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI677C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I678C (NT445)
Plasmid#50879PurposeExpresses human NKCC1 I678C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI678C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L736C (NT522)
Plasmid#50890PurposeExpresses human NKCC1 L736C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationL736C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C (NT441)
Plasmid#50876PurposeExpresses human NKCC1 A675C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationA675C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I730C (NT504)
Plasmid#50884PurposeExpresses human NKCC1 I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A735C (NT509)
Plasmid#50889PurposeExpresses human NKCC1 A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationA735C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 S679C (NT447)
Plasmid#50880PurposeExpresses human NKCC1 S679C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationS679C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N680C (NT468)
Plasmid#50881PurposeExpresses human NKCC1 N680C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN680C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C A734C (NT841)
Plasmid#50864PurposeExpresses human NKCC1 A675C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationA675C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 S679C I730C (NT838)
Plasmid#50869PurposeExpresses human NKCC1 S679C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationS679C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C I730C (NT835)
Plasmid#50863PurposeExpresses human NKCC1 I674C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI674C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I677C A734C (NT813)
Plasmid#50868PurposeExpresses human NKCC1 I677C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI677C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDRM56 tet-AR(1-707)C617Y
Plasmid#183504PurposeLentiviral vector expressing a doxycycline-inducible truncated DNA-binding mutant androgen receptor (AR mutant C617Y)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationTruncated mutant AR; spans AR 1-707 aa, and conta…PromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Esrrb
Plasmid#71152PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine EsrrbDepositorInsertEstrogen related receptor, beta (Esrrb Mouse)
UseLentiviralExpressionMammalianPromotertetOAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLOC-MCOLN1
Plasmid#131583PurposeFor expression of human MCOLN1 in mammalian cells, GFP-taggedDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ECT2
Plasmid#183835PurposeRepair template for the N-terminal tagging of Ect2 with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertECT2 homology arms with mNeonGreen-linker (ECT2 Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet2_bGHpA
Plasmid#177352PurposeAAV expression of scFV-fused catalytic domain of TET2 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterCMV promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMeCP2G pc1121
Plasmid#167566PurposeThe complete rat MeCp2 ORF is fused in frame of the NH2-terminus of the enhanced GFP (isolated from pEGFP-N1 vector; CLONTECH Laboratories, Inc.)DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe2-WT
Plasmid#85845PurposeDonor plasmid for SNCA exon2 wild type sequence. Also contains TagBFP and EGFPDepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVtet2_bGHpA
Plasmid#177353PurposeAAV expression of scFV-fused catalytic domain of TET2 from Synapisin promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…Promoterhuman Synapsine promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO h-Stx3 L165A/E166A-2xMyc/His
Plasmid#99743PurposeExpresses human Stx3 locked into the open conformation with a C-term myc-myc-his tag in mammalian cells.DepositorInsertStx3 (STX3 Human)
Tagsmyc-myc-hisExpressionMammalianMutationChanged both L165 and E166 to AlaninePromoterCMVAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNIL BSD-mApple
Plasmid#182313PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into lower motor neurons via NGN2, ISL1, and LHX3 expression, bsd selection, mAppleTagsT2A-mycNLS-mAppleExpressionMammalianAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-GAI1-92-KRas/N12-KRas/13C(Q61L)-GID1-mVenus-CAAX
Plasmid#232262PurposeExpress split-KRas fragments that are fused with CIDs and FPsDepositorTagsmCerulean and mVenusExpressionMammalianMutationKRas-Q61LPromoterCMVAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-GAI1-92-KRas/N12-KRas/13C(S17N)-GID1-mVenus-CAAX
Plasmid#232263PurposeExpress split-KRas fragments that are fused with CIDs and FPsDepositorTagsmCerulean and mVenusExpressionMammalianMutationKRas-S17NPromoterCMVAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIS2-hsSTAM1 (1-143)
Plasmid#21498DepositorAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pylT-AznLRS
Plasmid#172482PurposeFor E.Coli expression, 306L309L348I384F411WDepositorInsertAznLRS and pylTcua
ExpressionBacterialPromoteraraBADAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
YFP-Rac2(N17)
Plasmid#11398DepositorInsertras-related C3 botulinum toxin substrate 2 (RAC2 Human)
TagsYFPExpressionMammalianMutationObtained with Threonine 17 changed to Asparagine.Available SinceFeb. 21, 2007AvailabilityAcademic Institutions and Nonprofits only