We narrowed to 2,726 results for: ICL
-
Plasmid#119942Purposeencodes a GAG (F-MLV)-CAS9(sp) fusion. Allows the production of GAG-CAS9 Virus like particles from producer cells in association with over expressed gRNA(s) and appropriate envelopes.DepositorInsertGAG FMLV fused to spCAS9
TagsFLAGExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FuG-E (P440E)
Plasmid#119978PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. If you use this plasmid, you can make type E (P440E) envelope coating virus particle with NeuRet.DepositorInsertFusion Glycoprotein type E (P440E)
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FuG-C
Plasmid#67512PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. If you use this plasmid, you can make type C envelope coating virus particle with NeuRet.DepositorInsertFusion Glycoprotein type C
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:IL2_SigP:NLuc
Plasmid#197266PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human IL2 locus (exon 3). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertInterleukin-2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-total_SigP:NLuc
Plasmid#197267PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (both isoforms). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-total homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag CAMKV
Plasmid#20443DepositorAvailable SinceMarch 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Multiplex-CRISPR-miR-200FAM-T2A-GFP
Plasmid#179856Purposeto delete miR200 family genes including miR-141, miR-200c, miR-429 and miR-200bDepositorInsertUseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
BIC-Gag-DDX3
Plasmid#233687PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.DepositorInsertDEAD-box helicase 3 (DDX3X Human)
UseRetroviralTagsGag (Murine Leukemia Virus)ExpressionMammalianPromoterhCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
IF189
Bacterial Strain#134836PurposeRapid and efficient recombineering and purificiation of modified lambda phage DNADepositorBacterial ResistanceNoneAvailable SinceJan. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
EcAR7
Bacterial Strain#52055PurposeStrain for use in Rinehart Lab Phosphoprotein synthesis kitDepositorBacterial ResistanceNoneAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
DH10B E. coli aptI/gidB::Landing Pad
Bacterial Strain#83036PurposeFor site-specific chromosomal insertion of a target DNA sequence at an engineered landing pad site in the atpI/gidB locus.DepositorBacterial ResistanceTetracyclineAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
BW-Para
Bacterial Strain#172602PurposeThe BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays.DepositorBacterial ResistanceNoneAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
CJW4617
Bacterial Strain#177118PurposeE. coli strain carrying IPTG-inducible gfp-muNS gene for monitoring the mobility of cytoplasmic particles.DepositorBacterial ResistanceKanamycinAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Antibody#209588-rAbPurposeAnti-Kvbeta1.2/KCNAB1 K+ channel (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsWestern BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceOct. 21, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#207115-rAbPurposeAnti-Beta-2-microglobulin [BBM.1] (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistryReactivityHumanSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceNov. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits