We narrowed to 2,692 results for: ICL
-
Plasmid#233687PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.DepositorInsertDEAD-box helicase 3 (DDX3X Human)
UseRetroviralTagsGag (Murine Leukemia Virus)ExpressionMammalianPromoterhCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
IF189
Bacterial Strain#134836PurposeRapid and efficient recombineering and purificiation of modified lambda phage DNADepositorBacterial ResistanceNoneAvailable SinceJan. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
EcAR7
Bacterial Strain#52055PurposeStrain for use in Rinehart Lab Phosphoprotein synthesis kitDepositorBacterial ResistanceNoneAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
DH10B E. coli aptI/gidB::Landing Pad
Bacterial Strain#83036PurposeFor site-specific chromosomal insertion of a target DNA sequence at an engineered landing pad site in the atpI/gidB locus.DepositorBacterial ResistanceTetracyclineAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
BW-Para
Bacterial Strain#172602PurposeThe BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays.DepositorBacterial ResistanceNoneAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Antibody#209588-rAbPurposeAnti-Kvbeta1.2/KCNAB1 K+ channel (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsWestern BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceOct. 21, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
CJW4617
Bacterial Strain#177118PurposeE. coli strain carrying IPTG-inducible gfp-muNS gene for monitoring the mobility of cytoplasmic particles.DepositorBacterial ResistanceKanamycinAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Antibody#207115-rAbPurposeAnti-Beta-2-microglobulin [BBM.1] (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistryReactivityHumanSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceNov. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#180103-rAbPurposeAnti-Olig1 (Mouse) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistry and ImmunohistochemistryReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#180085-rAbPurposeAnti-Arl13b (Mouse) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityMouse and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241000-rAbPurposeAnti-Glypican 5 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human GPC5. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#240999-rAbPurposeAnti-Glypican 4 (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes mouse and human GPC4. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241001-rAbPurposeAnti-Glypican 6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse GPC6. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#240996-rAbPurposeAnti-Glypican 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse GPC1. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
lentiCas9-Blast (Lentiviral Prep)
Viral Prep#52962-LVPurposeReady-to-use Lentiviral Prep particles produced from lentiCas9-Blast (#52962). In addition to the viral particles, you will also receive purified lentiCas9-Blast plasmid DNA. Lentiviral particles carrying Cas9 and blasticidin resistance. This virus is used to make stable cell lines expressing Cas9.DepositorPromoterEFS-NSAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Hygro (656-4) (Lentiviral Prep)
Viral Prep#17446-LVPurposeReady-to-use Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA. Lentiviral particles carrying the GFP and hygromycin resistance.DepositorAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V1 (Concentrated Lentiviral Prep)
Viral Prep#115643-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V1 (#115643). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V1 plasmid DNA. <p><p>Ready-to-use lentiviral particles carrying version 1 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.</p></p>DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V3 (Concentrated Lentiviral Prep)
Viral Prep#115645-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V3 (#115645). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V3 plasmid DNA. Ready-to-use lentiviral particles carrying version 3 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V2 (Concentrated Lentiviral Prep)
Viral Prep#115644-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V2 (#115644). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V2 plasmid DNA. Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only