We narrowed to 6,269 results for: pAAV
-
Plasmid#192602PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DIO-GRAB_CRF1.0
Plasmid#208662PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0 in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0
UseAAVPromoterEFSAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEO-CaMKII-EGFP
Plasmid#177018PurposeFor expression of EGFP in a single-floxed, excisable open reading frame (cre-off), under control of the CaMKIIa promoterDepositorInsertEGFP
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-alphaCaMKII-E2-Crimson-3XNLS-pA
Plasmid#183803PurposeAAV vector to express nuclear localized E2-Crimson from CaMKIIa promoterDepositorInsertE2-Crimson-NLS
UseAAVTagsNLSAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb559-562del-HA
Plasmid#204351PurposeExpresses a mutant PDGFRb gene (559-562 deletion). Used for DNA delivery using Adeno-associated Virus.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
UseAAVTagsHAMutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synp-F-H2B-GCaMP6f
Plasmid#102994PurposeExpresses histone fused GCaMP6f under the synapsin promoterDepositorInsertH2B-GCaMP6f
UseAAVExpressionMammalianPromoterhuman synapsin I promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pEF1a-DIO-tTAc
Plasmid#172126PurposeExpression of InteinC-tTAC in Cre recombinase positive cellsDepositorInsertInteinC-tTAc
UseAAVPromoterCaMKIIAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-CB2gRNA-CBh-mCherry
Plasmid#91948PurposeExpression of gRNA for mouse CB2 cannabinoid receptor and mCherryDepositorInsertmCherry
UseAAVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184V
Plasmid#106190PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterCAGAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV TBG FFluc miR122sponge
Plasmid#35657DepositorInsertmiR-122 sponge
UseAAVPromoterTBGAvailable SinceJuly 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJEP306-pAAV-EFS-MCS3-pA
Plasmid#113682PurposeEFS driven Multi Cloning Site-3.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-splitTVA800
Plasmid#59330PurposeExpresses splitTVA800DepositorInsertsplitTVA800
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
LITE1.0_pAAV_hSyn_TALE(Grm2)-NLS-CIB1_2A_GFP_WPRE_bGHpA
Plasmid#47453PurposeepiLITE / LITE1.0 TALE-CIB1. CIB1 binds to blue-light-activated CRY2PHR. Particular TALE targeted to Grm2 promoter. Synapsin promoter for neuronal expression.DepositorInsertTALE (N136,Grm2,C63)-cib1
UseAAV; TaleTagsHAExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-rev-g2-2A-Venus
Plasmid#71410PurposeThis plasmid is pAAV-panpromoter-flex-rev-gamma2F77-2A-Venus. Confers zolpidem sensitivity on zolpidem-insensitive neurons.DepositorInsertsUseAAV and Cre/LoxExpressionMammalianPromotermouse hdc gene promoter, works as a pan neuronal …Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only