We narrowed to 6,509 results for: cas9 expression plasmid
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSP469
Plasmid#65771PurposeHuman expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP680
Plasmid#65772PurposeHuman expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)PromoterAvailable sinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
AZ64_pE.DonorCLYBL.TS
Plasmid#199228PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for EGFP reporter
UseGene targeting donor plasmidTagsExpressionMammalianMutationPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-Lib
Plasmid#53121PurposesgRNA expression construction in a 3rd generation lentiviral backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCASB
Plasmid#190175PurposePlasmid for yeast expression of Cas9; contains a golden gate cloning site to additionally express a gRNA for a target sequenceDepositorInsertsgRNA cloning site
UseTagsExpressionBacterial and YeastMutationAdded 5'-agagacc-3' upstream and 5'…PromoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORFE1001
Plasmid#112079PurposeOverexpression of the AtCAS9 in plant under 2x35S promoterDepositorInsertAtCAS9
UseCRISPRTagsExpressionPlantMutationPlant codon optimized Cas9 S. pyogenesPromoter2x35SAvailable sinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorInsertCyr1CT-sgRNA (CYR1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX552
Plasmid#60958PurposepAAV-U6sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and nuclei.DepositorInsertsU6_(SpaI)_sgRNA
Syn_EGFP-KASH
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMammalianMutationPromoterSynapsin and U6Available sinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS2-3xFLAG-2xNLS
Plasmid#107303PurposeExpresses ZFP-VEGFA-TS2 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS2
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianMutationPromoterCMV IE94Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS3-3xFLAG-2xNLS
Plasmid#107304PurposeExpresses ZFP-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS3
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianMutationPromoterCMV IE94Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
psBIG1a
Plasmid#229957PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG1b
Plasmid#229958PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG2abc
Plasmid#229963PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG2ab
Plasmid#229962PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG2abcd
Plasmid#229964PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG2abcde
Plasmid#229965PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG1d
Plasmid#229960PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only