We narrowed to 3,357 results for: phage
-
Plasmid#207862PurposeAAV genome encoding C-terminal PEmaxDRNaseH and U6 expression cassettes for Dnmt1 PE3 pegRNA and ngRNADepositorInsertNpuC-Cterm-PEmaxDRNaseH-dualU6-Dnmt1-PE3-loxP
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB
Plasmid#162572PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency.DepositorInsertsLambda Red-Beta
E. coli SSB
ExpressionBacterialPromoterpBADAvailable SinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPtGE35
Plasmid#107999PurposeExpresses TevCas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
I-TevI nuclease and partial linker domain
UseCRISPR and Synthetic Biology; Episomal vector for…TagsCas9Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
hGFAP-Cre
Plasmid#40591PurposeMouse astrocyte expression of CreDepositorInsertCre recombinase (GFAP Human, Mouse, Phage)
UseCre/Lox and Mouse TargetingTagsMP-1 fragment (mouse protamine 1 intron and polya…ExpressionMammalianMutationConstruct contains a nuclear-targeted Cre recombi…PromoterhGFAP promoterAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PEmaxdeltaRNaseH-dualU6-Rosa26-twinPE-attB
Plasmid#207859PurposeAAV genome encoding C-terminal PEmaxDRNaseH and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PEmaxDRNaseH-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2EFCRET(#324)
Plasmid#184059Purposecyclofen-inducible CRE activation in zebrafish transient transgenicDepositorInsertCRE-ERT2
UseZebrafish transient transgenesisMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterXl-EF1aAvailable SinceJuly 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22iU66CriT(#387)
Plasmid#184061Purposecyclofen-inducible CRE activation in zebrafish permanent transgenicDepositorInsertCRE-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEX_lambdaterminase
Plasmid#248952Purposephage lambda large terminase subunit under control of a crystal violet inducible promoterDepositorInsertlambdaterminase
ExpressionBacterialAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6c
Plasmid#207853PurposeMammalian expression of PE6c prime editorDepositorInsertPE6c
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
NINJA TC
Plasmid#159274PurposeExpresses the NINJA targeting construct (inducible neoantigen expression via cumulative Cre, rtTA, doxycycline and tamoxifen).DepositorInsertNINJA TC
UseMouse TargetingExpressionMammalianAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB-EcMutLE32K
Plasmid#162576PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency. Contains a dominant negative mismatch repair protein.DepositorInsertsLambda Red-Beta
E. coli SSB
EcMutLE32K
ExpressionBacterialMutationE32K mutated to give dominant negative phenotypePromoterpBADAvailable SinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSCRET2(#323)
Plasmid#184058Purposecyclofen-inducible CRE activation via mammalian cell transfection or mRNA synthesisDepositorInsert6myc-CRE-ERT2
UseSynthetic BiologyTags6xMycExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceJuly 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZB246-T7-T+
Plasmid#250903PurposeExpresses N-terminal His-tag thermally stabilized T7 RNAP under a lac-inducible promoter on Kanamycin Resistance BackboneDepositorInsertThermally Stable T7 RNA Polymerase
Tags6xHisExpressionBacterialMutationArginine 31 to Aspartic Acid, Alanine 61 to Argin…PromoterpT5-lacUVAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC18T-mini-Tn7T-Gm-CC
Plasmid#246943PurposePlasmid strain containing pUC18T-mini-Tn7T-Gm-CC01 plasmid, which will insert a nonsense spacer version of the synthetic CRISPR-Cas system from P. aeruginosa PA14 into the genome at the att-Tn7 site.DepositorInsertType IF CRISPR-Cas system from Pseudomonas aeruginosa PA14
UseSynthetic BiologyExpressionBacterialPromoterNative promoters from PA14Available SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
UbC NLS-HA-MCP-YFP
Plasmid#31230DepositorInsertNLS-HA-MCP-YFP
UseLentiviralExpressionMammalianAvailable SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET29b(+)_gp1(A11V)
Plasmid#225131PurposePhage GIL01 protein gp1 (A11V) mutant with a single nucleotide substitution (C32T)DepositorInsertgp1 (A11V)
TagsHis-tagExpressionBacterialMutationAlanine 11 to ValinePromoterT7 promoterAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPSU2
Plasmid#89566PurposeHigh copy number plasmid 2 to prepare Penn State DNA molecular weight laddersDepositorInserts750 bp EcoRV fragment
3000 bp EcoRV fragment
4000 bp EcoRV fragment
50 bp PstI fragment
100 bp PstI fragment
200 bp PstI fragment
300 bp PstI fragment
400 bp PstI fragment
500 bp PstI fragment
600 bp PstI fragment
1500 bp Psti fragment
4100 bp PstI fragment
ExpressionBacterialAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-uvsX-H6
Plasmid#163913PurposeExpresses uvsX for bacterial expression and affinity purificationDepositorInsertuvsX
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only