We narrowed to 24,015 results for: FUS
-
Plasmid#62456PurposeHis6-halo tagged human Keap1 protein for E.coli expressionDepositorAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pMIR-His-Halo-Tev-PTEN
Plasmid#58241Purposeexpresses halo tagged PTEN proteinDepositorInsertphosphatase and tensin homolog (PTEN Human)
TagsHis-Halo-TevExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SuperNovaGreen-T2A-dTomato
Plasmid#193798PurposeExpresses SuperNova Green in the cytosol of mammalian cells, joined by a T2A cleavage site with dTomatoDepositorInsertSuperNova Green
UseAAVTagsFlag tagExpressionMammalianPromoterCAGAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-Gata1
Plasmid#41085DepositorAvailable SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
PHY98-LMNA 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#164046PurposeCRISPR donor plasmid to insert TriTag (mTagBFP) into the N-terminus of human LMNA geneDepositorInsertmTagBFG-TriTag
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Dsred-IRES-His Keap
Plasmid#62457Purposeexpresses his tagged human Keap1 proteinDepositorAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA24-pHR-CMV-stdMCP-p65-HSF1-T2A-GFP
Plasmid#199455PurposeExpression of stdMCP-PH in mammalian cellsDepositorInsertstdMCP-PH
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0002
Plasmid#42242PurposegRNA targeted to zebrafish gene drd3DepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mouse NT
Plasmid#242421PurposeExpression of a non-targeting shRNA in mouse cellsDepositorInsertNon-targeting shRNA
ExpressionMammalianPromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-shRNA2-zsGreen-PGK-puro_HSALNG0104472-163
Plasmid#197902PurposeFor the stable knockdown experiments using shRNA, a complementary sequence (HSALNG0104472-163) targeting the HSALNG0104472 transcript was inserted.DepositorInsertHSALNG0104472-163 (HSALNG0104472-scramble-sequence)
UseLentiviralTagszsGreen1ExpressionMammalianMutation15q11.2 deletionAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA29-pCS2-CMV-Zebrafish NarTag (eGFP)
Plasmid#199460PurposeExpression of Zebrafish NarTag (eGFP harbors 9XMS2 in its intron) in zebrafish embryosDepositorInsertZebrafish NarTag
ExpressionMammalianPromoterCMVAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miniSOG-C-Far
Plasmid#193914PurposeControl plasmid that expresses miniSOG targeted to the cell membrane in mammalian cellsDepositorInsertminiSOG
UseAAVTagsFarnesylation signal sequence and Flag tagExpressionMammalianPromoterCAGAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
PW124-LMNA 5'HA-TriTag (mCherry)-3'HA (HDR donor)
Plasmid#164047PurposeCRISPR donor plasmid to insert TriTag (mCherry) into the N-terminus of human LMNA geneDepositorInsertmCherry-TriTag
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-Flpo (AAV Retrograde)
Viral Prep#174378-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-syn-Flpo (#174378). In addition to the viral particles, you will also receive purified pAAV-syn-Flpo plasmid DNA. Syn-driven expression of the recombinase FLPo. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-GFP
Plasmid#58977Purposeexpression of GFP using a self-replicating Venezuelan equine encephalitis (VEE) virus RNA repliconDepositorInsertEGFP
UseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoter26S subgenomic promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10530
Plasmid#239266PurposeExpresses NES-dCas13b-ABI for CRISPR-TO perturbation in the cytoplasm of cell linesDepositorInsertNES-dPspCas13b-EGFP-ABI
UseCRISPR and LentiviralTagsFlag tag and V5 tagExpressionMammalianMutationH133A and H1058A in PspCas13bPromoterEF1aAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-EGFP-P2A-EGFPf-WPRE-HGHpA
Plasmid#74513PurposeAAV vector that use human synapsin-1 promoter to drive the expression of EGFP and membrane-targeted EGFPf linked by self-cleaving P2A peptide.DepositorInsertEGFP-p2A-EGFP-f
UseAAVAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only