We narrowed to 8,398 results for: tre promoter
-
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionTagsExpressionMutationPromoterArabidopsis U6 polymerase III promoterAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE-EF1a-MICB*005-IRES-ZsGreen
Plasmid#114008PurposeInduces expression of human MICB allele 005 cDNADepositorInsertMICB*005 (MICB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a MICA*009-IRES-ZsGreen
Plasmid#114007PurposeInduces expression of human MICA allele 009 cDNADepositorInsertMICA*009 (MICA Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-P33-shR
Plasmid#208359PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b-P33 mutantDepositorInsertSec22b (Sec22b Rat)
UseTagsEGFPExpressionMammalianMutationfour silent mutations (shRNA resistance), 33 aa p…PromoterCMVAvailable sinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1213 - pL0_p16OMT (pro + 5U)
Plasmid#203890Purpose16OMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsert16OMT promoter and 5'UTR
UseTagsExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …PromoterAvailable sinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1214 - pL0_pNMT (pro + 5U)
Plasmid#203893PurposeNMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertNMT promoter and 5'UTR
UseTagsExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …PromoterAvailable sinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆sap-NLS-3XFLAG-V5
Plasmid#196091PurposeExpresses mouse SAFB lacking the n-terminal SAP domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 31-65 (SAP domain) of mouse S…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆rrm-NLS-3XFLAG-V5
Plasmid#196093PurposeExpresses mouse SAFB lacking the rrm domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 428-506 (RRM) of mouse SAFB p…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-mCherry
Plasmid#122959PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with mCherry expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xmyc tagExpressionMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-EGFP
Plasmid#122956PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xhis tagExpressionMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd1-NLS-3XFLAG-V5
Plasmid#196092PurposeExpresses mouse SAFB lacking the first computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 96-285 (predicted disordered …PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd3-NLS-3XFLAG-V5
Plasmid#196094PurposeExpresses mouse SAFB lacking the third computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 638-925 (predicted disordered…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-SAFB-DD3-NLS-3XFLAG-V5
Plasmid#196095PurposeExpresses only the third computationally called disordered domain of mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationContains only AA 619-925 (NLS and predicted disor…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR (mut - miR-206 site)
Plasmid#62576PurposeTranslational Luciferase Reporter containing the mutated 3'UTR of RASA1. The miR-206 binding site was mutated.DepositorInsertRASA1 (RASA1 Human)
UseLuciferaseTagsNoneExpressionMutationmiR-206 binding site mutated (ACATTCCA --> AAC…PromoterAvailable sinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta EGF repeats (N2NL-delta EGF)-ires-EGFP
Plasmid#122955PurposeLentiviral expression of NOTCH2NL delta EGF repeats under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta EGF repeats (NOTCH2NLB Human)
UseLentiviralTags6xhis tagExpressionMutationdeletion of EGF repeats from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7A)-ATOH1 (SA Substitutions)
Plasmid#172309PurposeIn vitro transcription of ATOH1 (Ser phosphosites substituted by Ala)DepositorInsertATOH1 (ATOH1 Human)
UseOtherTagsExpressionMutationS331A, S342APromoterT7 promoter A-initiatingAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenWT-Puro
Plasmid#135676PurposeConstitutive expression (cMV promoter) of wildtype Pten cDNA, Puromycin selectionDepositorInsertPten (Pten Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
TYK2A-c075
Plasmid#53688PurposeBaculovirus expression for structure determination; may not be full ORFDepositorInsertTYK2A (TYK2 Human)
UseBaculovirus expressionTagsHis6-TEVExpressionMutationPromoterpolyhedrin promoterAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACYCduet-mxLOX2-EH
Plasmid#104979PurposeBiosynthesis of oxylipins by microbial enzymesDepositorUseTagsExpressionBacterialMutationPromoterT7 promoterAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-ABEmax-P2A-EGFP-ires-puro
Plasmid#121170PurposeCAG promoter driven expression of ABEmax base editor, EGFP and Puromycin resistance.DepositorInsertABEmax-P2A-EGFP-ires-puro
UseCRISPRTagsP2A-EGFP-ires-puroExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-FNLS-T2A-EGFP-ires-puro
Plasmid#121169PurposeCAG promoter driven expression of FNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-xFNLS-T2A-EGFP-ires-puro
Plasmid#121171PurposeCAG promoter driven expression of xFNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertxFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-tRNA-SpCas9
Plasmid#195183PurposeVector for transient Cas9 and EGFP expression. Small tRNA promoter for sgRNA cloning by GoldenGate.DepositorInsertCas9
UseCRISPRTagsExpressionMutationPromotertRNA-GlnAvailable sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-CV-B3_3C
Plasmid#203499PurposeExpresses CV-B3 3C protease from a GAL promoter with a URA3 markerDepositorInsertCV-B3 3C protease (D1P32_gp1 )
UseTagsExpressionYeastMutationPromoterGAL1Available sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-3x-uC-ccdB-6stop
Plasmid#203514PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (3x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-2x-uA-ccdB-6stop
Plasmid#203517PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (2x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-SV-A_3C
Plasmid#203474PurposeExpresses SV-A 3C protease from a GAL10 promoter with a URA3 markerDepositorInsertSV-A 3C protease (Hk1_gp1 )
UseTagsExpressionYeastMutationPromoterGAL10Available sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-DIPP3B-HA
Plasmid#183949PurposeExpresses human HA-tagged DIPP3B from yeast GPD promoterDepositorInsertDIPP3B (NUDT11 Human)
UseTagsHAExpressionYeastMutationWTPromoterGPDAvailable sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.0-mIghg2c
Plasmid#127159PurposeExpression of secretory immunoglobulin heavy chains in mammalian cells, mouse (C57BL/6), IgG2c isotypeDepositorInsertIghg2c (Ighg2c Mouse)
UseTagsExpressionMammalianMutationPromoterhCMV IE1 gene promoterAvailable sinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDUAL SRBI (GFP)
Plasmid#86979PurposeLentiviral expression construct encoding SR-B1 and GFP from separate promotersDepositorInsertSCARB1 (SCARB1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV/hPGKAvailable sinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pAG416GAL10-HPeV_3C
Plasmid#203465PurposeExpresses HPeV 3C protease from a GAL10 promoter with a URA3 markerDepositorInsertHPeV 3C protease (polyprotein gene )
UseTagsExpressionYeastMutationPromoterGAL10Available sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
M71 pGL3 Sp5l P1203 mut
Plasmid#17209DepositorInsertSp5l promoter (sp5l Zebrafish)
UseLuciferaseTagsluciferaseExpressionMutation6 of the putative Tcf/Lef sites mutatedPromoterAvailable sinceMay 18, 2009AvailabilityAcademic Institutions and Nonprofits only -
JDS246
Plasmid#43861PurposeExpresses mammalian codon optimized Cas9 nuclease with C-term 3X FLAG from CMV and T7 promotersDepositorInsertmammalian codon-optimized streptococcus pyogenes Cas9 - 3X Flag
UseCRISPRTags3X FLAGExpressionMammalianMutationPromoterCMVAvailable sinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-c-Src
Plasmid#203462PurposeExpresses human c-Src kinase from a GAL10 promoter with a URA3 markerDepositorInsertc-Src (CSK Human)
UseTagsExpressionYeastMutationPromoterGAL10Available sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
p5E-elavl3
Plasmid#72640PurposeGateway p5E 5'entry clone with elavl3 (HuC) enhancer/promoter for pan-neuronal expression in zebrafishDepositorInsertelavl3 enhancer (elavl3 Zebrafish)
UseTagsExpressionMutationPromoterAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDsRed1-CMV-Rat Nurr1-DsRed1-pA
Plasmid#233275PurposeTo Express a Rat Nurr1-DsRed fusion protein from a CMV promoterDepositorInsertrat Nurr1 DsRed fusion (Npas1 Rat)
UseTagsDsRed1ExpressionMammalianMutationP2APromoterAvailable sinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only