We narrowed to 9,450 results for: tre promoter
-
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
ExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-TRIM24
Plasmid#65396PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pbZIP9:GFP-GUS
Plasmid#172483PurposeGFP-GUS driven by the bZIP9 promoterDepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NLB (N2NL-FL)-ires-mCherry
Plasmid#122957PurposeLentiviral expression of NOTCH2NLB full length under CAG promoter with mCherry expressionDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NLB (N2NL-FL)-ires-EGFP
Plasmid#122954PurposeLentiviral expression of NOTCH2NLB full length under CAG promoter with EGFP expressionDepositorAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
TKTL1
Plasmid#72419PurposeStudy the role of aberrant expression of TKTL1 in HNSCC tumorigenesisDepositorInsertTKTL1 (TKTL1 Human)
ExpressionMammalianMutationmay have one or two synonymous substitutionsPromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-shR
Plasmid#208358PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22bDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations introduced to render shRNA …PromoterCMVAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMKIIa-SpyTag-C1C2-mCherry
Plasmid#69833PurposeLentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing SpyTag-C1C2-mCherry fusion. SpyTag can be used to monitor membrane localization of the C1C2 opsin.DepositorInsertSpyTag-C1C2
UseLentiviralTagsTrafficking signal and mCherryExpressionMammalianMutationInserted SpyTag after the signal peptide of C1C2.PromoterCamKIIaAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1-F250D pET151
Plasmid#159385PurposeExpresses human TLNRD1 F250D mutant in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 F250D mutant (TLNRD1 Human)
TagsHis-tag, TEV cleavage siteExpressionBacterialMutationChanged Phenylalanine 250 to Aspartic Acid (F250D)PromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-Y2404F
Plasmid#182846Purposemutation Y2404F (TAC/TTC) in GST-TRR-C421 (TRR 2011-2431 aa). Expression in E. coli. by IPTG inductionDepositorInsertTRR 2011-2431 (trr Fly)
ExpressionBacterialMutationmutation Y2404F (TAC/TTC) in GST-TRR-C421 (TRR 20…Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (WT - miR-206 site)
Plasmid#62577PurposeTranslational Luciferase Reporter containing a fragment of the 3'UTR of SPRED1 containing a miR-206 binding siteDepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.BRWD3-V5H
Plasmid#48624PurposeExpresses Drosophila BRWD3 (with V5 and His tags at the C-terminus) in mammalian cellsDepositorInsertBRWD3 (BRWD3 Fly)
TagsV5 and His tagsExpressionMammalianMutationno mutations, stop was removed to fuse V5His at C…PromoterCMVAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSB278 - pL0_pT16H2 (pro + 5U)
Plasmid#203889PurposeT16H2 promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertT16H2 promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI or BsaI cut site for MoClo domes…Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1224 - pL0_pT3R (pro + 5U)
Plasmid#203892PurposeT3R promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertT3R promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI or BsaI cut site for MoClo domes…Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1215 - pL0_pDAT (pro + 5U)
Plasmid#203895PurposeDAT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertDAT promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI or BsaI cut site for MoClo domes…Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM1-RRM2-V5His6_H
Plasmid#146490PurposeInsect Expression of DmPABPC1-RRM1-RRM2DepositorInsertDmPABPC1-RRM1-RRM2 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM2-RRM3-V5His6_H
Plasmid#146491PurposeInsect Expression of DmPABPC1-RRM2-RRM3DepositorInsertDmPABPC1-RRM2-RRM3 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM3-RRM4-V5His6_H
Plasmid#146492PurposeInsect Expression of DmPABPC1-RRM3-RRM4DepositorInsertDmPABPC1-RRM3-RRM4 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-V5His6_H
Plasmid#146499PurposeInsect Expression of DmGW182DepositorInsertDmGW182 (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-DmPABPC1-RRM1-RRM2-V5His6_H
Plasmid#146479PurposeInsect Expression of DmPABPC1-RRM1-RRM2DepositorInsertDmPABPC1-RRM1-RRM2 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_1-550-siRNAres_L
Plasmid#146859PurposeInsect Expression of DmPABPC1_1-550-siRNAresDepositorInsertDmPABPC1_1-550-siRNAres (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and six silent muta…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_90-635-siRNAres-V5His6_L
Plasmid#146860PurposeInsect Expression of DmPABPC1_90-635-siRNAresDepositorInsertDmPABPC1_90-635-siRNAres (pAbp Fly)
ExpressionInsectMutationfive silent mutations compared to the sequence gi…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-del91-164-V5His6_L
Plasmid#146861PurposeInsect Expression of DmPABPC1_del91-164DepositorInsertDmPABPC1_del91-164 (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and five silent mut…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1-4H pET151
Plasmid#159386PurposeExpresses human TLNRD1 4-helix domain (residues 143-273) in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 (TLNRD1 Human)
Tagshis-tag, TEV cleavage siteExpressionBacterialMutationTLNRD1 4-helix domain (residues 143-273)PromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-Incenp d543-746iPRC1_279-482-GFP
Plasmid#108500Purposeinducible expression of vsv-INCENP d543-746iPRC1 279-482-EGFPDepositorInsertINCENP d543-746iPRC1 304-509 (PRC1 Human)
TagsEGFP and VSVExpressionMammalianMutationdelta alpha Helix, insert PRC1 microtubule domainPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-vsv-Incenp d543-746iPRC1_279-482-GFP
Plasmid#108504Purposeinducible expression of vsv-INCENP d543-746iPRC1 279-482-EGFPDepositorInsertINCENP d543-746iPRC1 304-509 (PRC1 Human)
TagsEGFP and VSVExpressionMammalianMutationdelta alpha Helix, insert PRC1 microtubule domainPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS415-GPD-PPK
Plasmid#183941PurposeExpresses E. coli PPK from yeast GPD promoterDepositorAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-VGF
Plasmid#107575PurposeEncodes the entire VGF cDNA sequence under the control of CMV promoter. Allows expression of VGF in mammalian cells.DepositorAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTJK438
Plasmid#138004Purpose3xMYC-SIX1 expression. Vector also expresses GFP under control of hUBC promoterDepositorAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-SCN8A-Variant-1-IRES-mScarlet
Plasmid#162280PurposeEukaryotic expression of human SCN8A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.DepositorInsertSCN8A Variant 1, stabilized (SCN8A Human)
TagsIRES-mScarletExpressionMammalianMutationModified human HSPA5 intron 4 inserted after bp23…PromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-pphlO6-crtYBI
Plasmid#165977PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and 2,4-diacetylphloroglucinol in yeast expressing PhlTA and LuxTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-Avi-Cerulean-RanGAP
Plasmid#79881PurposeUbiquitin promoter driving Avi-tagged protein containing Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1) (RANGAP1 Chicken)
TagsAviExpressionBacterialPromoterUbiquitin promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
NST3_pOpOn2.1
Plasmid#228066PurposeExpresses NST3 in different cell types in Arabidopsis thaliana upon induction with dexamethasone.DepositorInsertNAC SECONDARY WALL THICKENING PROMOTING FACTOR3, NST3 (NAC012 Mustard Weed)
UseDexamethasone inducible vectorExpressionPlantPromoterCaMV35S for LhGR and pOp6-minimal CaMV35S for NST3Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVtet2_bGHpA
Plasmid#177353PurposeAAV expression of scFV-fused catalytic domain of TET2 from Synapisin promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…Promoterhuman Synapsine promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-delLN-DmPABPC1-V5His6_H
Plasmid#146477PurposeInsect Expression of DmPABPC1DepositorInsertDmPABPC1 (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and seven silent mu…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-del183-258-siRNAres-V5His6_L
Plasmid#146862PurposeInsect Expression of DmPABPC1_del183-258-siRNAresDepositorInsertDmPABPC1_del183-258-siRNAres (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and seven silent mu…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only