We narrowed to 5,985 results for: actin
-
Plasmid#187893PurposeAll-in-one prime editor piggyBac transposon with PEmaxDepositorInsertSpCas9_H840A_KK-MMLV-RT_co-P2A-PAC_dTK
UseCRISPR and Synthetic Biology; Piggybac transposonTagsBPSV40 NLS and c-Myc NLSExpressionMammalianPromoterCAGAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-GECO2G
Plasmid#159605PurposeAAV production plasmid encoding for near-infrared calcium indicator NIR-GECO2GDepositorHas serviceAAV1, AAV2, and AAV9InsertNIR-GECO2G
UseAAVExpressionMammalianPromoterCAGAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LiOn*-CAG∞RFP
Plasmid#154019PurposeVector based on the LiOn integration-coupled translational switch and devoid of TTAA sequences, expressing the fluorescent protein mRFP1 from a CAG promoter upon action of the piggyBac transposaseDepositorInsertmRFP1
ExpressionMammalianMutationAll TTAA in vector backbone were replaced by sile…PromoterCAGAvailable sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (AAV Retrograde)
Viral prep#104495-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (#104495). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE plasmid DNA. CAG-driven, Cre-dependent GCaMP7s calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceOct. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VPH-T2A-GFP-IRES-Neo
Plasmid#102886PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192-p65-HSF1 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-p65-HSF1-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPB-CAG-rtTA-IN
Plasmid#60612PurposeBackbone for tet-inducible genesDepositorTypeEmpty backboneAvailable sinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-B19N
Plasmid#59924PurposeExpression vector for Rabies virus SAD B19 nucleoprotein geneDepositorInsertRabies virus nucleoprotein
ExpressionMammalianPromoterCAGAvailable sinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNW3
Plasmid#53372PurposeCsy4 and Cas9 D10A nickase expression plasmidDepositorInsertCsy4-T2A-Cas9n (D10A)
UseCRISPRExpressionMammalianPromoterCAGAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-T3-hCasD10A-pA
Plasmid#51638PurposeExpresses Cas9-nickase in mammalian cells and zygotes.DepositorInsertCodon-optimized Cas9 D10A
UseCRISPRTagsFLAG, NLS, and polyAExpressionMammalianPromoterCAG promoterAvailable sinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-GFP (AAV CAP-B10)
Viral prep#37825-CAP-B10PurposeReady-to-use AAV CAP-B10 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV were produced with the CAP-B10 serotype, which permits efficient transduction of both inhibitory and excitatory neurons in the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_VP35_EBOV
Plasmid#103050PurposeEncodes Ebola virus VP35 gene (Zaire ebolavirus, Mayinga) under control of the CAG promoterDepositorInsertVP35 gene of Ebola virus (VP35 (Zaire ebolavirus, Mayinga))
ExpressionMammalianPromoterCAGAvailable sinceDec. 20, 2017AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable sinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-PuroDTK.Neo
Plasmid#72307PurposePiggyBac Cassette contains puromycin and TK genesDepositorInsertPuromycin-DTK-neo
ExpressionBacterial and MammalianPromoterCAG promoterAvailable sinceFeb. 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-hGPR56-IRES-GFP
Plasmid#52297PurposeExpresses human GPR56 and GFP in mammalian cells.DepositorAvailable sinceApril 23, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-p65AD-GBP6
Plasmid#49440PurposeExpression of a GFP-dependent transcription factor component in mammalian cellsDepositorInsertGBP6-p65 transactivation domain fusion protein
ExpressionMammalianPromoterCAGAvailable sinceJan. 9, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-GBP1-10gly-Gal4DBD
Plasmid#49438PurposeExpression of a GFP-dependent transcription factor component in mammalian cellsDepositorInsertGBP1-Gal4 DNA binding domain fusion protein
ExpressionMammalianMutationC98S (to increase protein solubility), Q3DPromoterCAGAvailable sinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTALYM3-Telo1
Plasmid#47883PurposeTALE-mClover against telomere sequenceDepositorInsertTALE-mClover
UseTALENTagsmCloverExpressionMammalianPromoterCAGAvailable sinceOct. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1-F250D pET151
Plasmid#159385PurposeExpresses human TLNRD1 F250D mutant in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 F250D mutant (TLNRD1 Human)
TagsHis-tag, TEV cleavage siteExpressionBacterialMutationChanged Phenylalanine 250 to Aspartic Acid (F250D)PromoterT7Available sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only