We narrowed to 6,562 results for: nls
-
Plasmid#174827PurposeMammalian expression of SpCas9 prime editor 2 with P2A-human MLH1dn (codon optimized)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPE2-P2A-hMLH1dn
TagsSV40 bpNLSExpressionMammalianMutationDetailed in manuscript; deletion of residues 754-…PromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCI-NLS-BirA-2A-mCherry
Plasmid#127781PurposeBirA construct in a PCI nls backbone driving mCherry activityDepositorInsertBirA
UseUnspecifiedAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega2_[EBSn-mini35S:3x SV40-NLS:GUS:term35S]-[pNOS:KANAMYCIN:tNOS]
Plasmid#254072PurposeGUS expression driven by EBSnDepositorInsertEBSn:mini35S:3x SV40-NLS:GUS:35Sterm
UseSynthetic BiologyExpressionPlantAvailable sinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-TSC2-NLS
Plasmid#192441PurposeEncodes mCherry-tagged wild-type TSC2 isoform 5 targeted to the nucleus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry-TSC2-NLS (TSC2 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-EGFP-NLS hygro
Plasmid#87781PurposeInducible expression of EGFP with a C-terminal NLS sequenceDepositorInserteGFP
UseLentiviralTags3xFLAG and NLSExpressionMammalianAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pME-QUAS5x:GFPNLS-SV40pA
Plasmid#155115PurposeMiddle entry vector containing QUAS5x element upstream of GFP-NLS.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertQUAS5x:GFPNLS
UseGateway middle entry vectorPromoterQUAS5x-E1bAvailable sinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-T7-NlaCas3-NLS-6xHis
Plasmid#180214PurposeExpressing Neisseria lactamica Type I-C Cas3 with NLS and His tag on the C terminus for protein purification in E.ColiDepositorInsertNlaCas3c
Tags6xHis and NLSExpressionBacterialPromoterT7Available sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHeEf1a-mEGFP-NLS
Plasmid#205012PurposeThe vector contains 1kbp of the upstream and downstream regions of the ef1a gene from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the ef1a gene from Hypsibius exemplaris
UseTardigrade expressionAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-TDP-43deltaNLS-V5-APEX
Plasmid#229081PurposeDoxycycline-inducible expression of NLS-mutated TDP-43 fused to V5-tag and APEX for proximity labeling, containing BFP in the backboneDepositorInsertTDP-43deltaNLS (TARDBP Human)
TagsAPEX, BFP, and V5ExpressionMammalianMutationK82A, R83A, K84A, K95A, K97A and R98A for mutatio…PromoterTRE3GAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PE2max-BSD
Plasmid#191102PurposeLentiviral expression plasmid of PEmax prime editor with P2A-BSD markerDepositorInsertPEmax-P2A-BSD
UseCRISPR and LentiviralExpressionMammalianMutationChanged R221K, N394K, H840A from SpCas9PromoterEF-1aAvailable sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plenti-As-Cas12a-2xNLS
Plasmid#155047PurposeLentiviral vector expressing human codon-optimized _C-terminal Myc-tagged _Acidaminococcus sp. BV3L6 (As)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoterDepositorInsertAsCas12a
UseCRISPR and LentiviralTagsNucleoplasmin NLS, Myc-tag and SV40 NLSExpressionMammalianPromoterEF-1aAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCAV1-NLS-mCherry
Plasmid#187257PurposeLentiviral expression of shRNA targeting Caveolin1 and NLS-mCherryDepositorAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-CMV-Puro-2A-NLS-FLAG-cGAS
Plasmid#127656PurposeOver-express NLS-FLAG-cGASDepositorAvailable sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMSCV-NLS-CBRed-d2-hygro
Plasmid#139196Purposenon-ERK dependent control plasmid for pMSCV-NLS-CBGreen-FIRE-puroDepositorInsertCBRed
UseLuciferase and RetroviralTagsd2 PEST domain and nuclear localization signal (N…ExpressionMammalianAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
mApple-PCNA-19-NLS-4
Plasmid#54937PurposeLocalization: Nucleus, Excitation: 568, Emission: 592DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPCNA-19 NLS (PCNA Human)
TagsmAppleExpressionMammalianPromoterCMVAvailable sinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LN-entry+NLS
Plasmid#128011PurposeVector containing the lambdaN-entry expression cassette with SV40 NLS and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertLN-3xFlag-SV40NLS
UseLamdan entry vector with nls to generate tetherin…TagsLN-3xFlag-SV40NLSAvailable sinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMT-myl7-NLS-BirA-2A-mCherry_Ras
Plasmid#80061PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-enRVR(E174R/S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1931)
Plasmid#114075PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-enRVR(E174R/S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-enRVR (E174R/S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, K548V and N552RAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS581-pCSDest2-AcrIIC4Hpa-FLAG-NLS
Plasmid#113436PurposeExpresses a FLAG/NLS tagged type II-C anti-CRISPR protein from H. parainfluenzae in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttype II-C anti-CRISPR
UseCRISPRTagsFLAG/NLSExpressionMammalianPromoterCMVAvailable sinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by