We narrowed to 2,091 results for: 1186
-
Plasmid#1186DepositorInserthtt 103Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
tRNA-gRNA position [2_n-1] (GB1206)
Plasmid#75407PurposetRNA and scaffold for the assembly of GBoligomers for the intermediate position (positon [2_n-1]) of a polycistronic tRNA-gRNA (3-part multiplexing)DepositorInserttRNA-gRNA position [2_n-1]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_2] (GB1205)
Plasmid#75406PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_2]) of a polycistronic tRNA-gRNA regulated by the dicot U6-26 or U6-1 promoter (3-part multiplexing)DepositorInserttRNA-gRNA
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:VP64:tNos (GB1189)
Plasmid#75403PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the VP64 Transcriptional ActivatorDepositorInsertdCas:VP64
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertUseTags1D4ExpressionMammalianMutationPromoterCMVAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVM-SFT-SP
Plasmid#234902PurposeThis all-in-one vector is used to overexpress the GhSFT gene via virus-mediated overexpression (VOX), and specifically silence the GhSP gene via virus-induced gene silencing (VIGS), simultaneously.DepositorInsertAdditional VA component flanked with VIGS fragment of GhSP gene and coding sequence of GhSFT
UseTagsExpressionPlantMutationPromoterAvailable sinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TDP-43 (NLSmut)
Plasmid#235489PurposeExpression of human TDP-43-EGFP with mutated nuclear localization sequenceDepositorInsertTARDBP (TARDBP Human)
UseTagsEGFPExpressionMammalianMutationK82A, R83A, K84A, K95A, K97A, R98APromoterAvailable sinceMay 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-TDP-43 (4SA)
Plasmid#235499PurposeExpression of human TDP-43-EGFP with phospho-dead mutations in the C-terminusDepositorInsertTARDBP (TARDBP Human)
UseTagsEGFPExpressionMammalianMutationS403A, S404A, S409A, S410APromoterAvailable sinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-TDP-43 (5FL)
Plasmid#235491PurposeExpression of human RNA-binding deficient TDP-43-EGFPDepositorInsertTARDBP (TARDBP Human)
UseTagsEGFPExpressionMammalianMutationF124L, F127L, F147L, F149L, F152LPromoterAvailable sinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
DG SaCas9 GFP V3
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 GFP V3
Plasmid#226962PurposeCBh-SaCas9-2A-GFP, and hU6-sgRNA (Sa) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pdg459-eSp(1.1) V3
Plasmid#226965PurposeCBh-eSpCas9(1.1)-2A-Puro, and 2X hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PDG458 eSp(1.1) V3
Plasmid#226964PurposeCBh-eSpCas9(1.1)-2A-GFP, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorInsertSNF1-related protein kinase 2.3 (SNRK2.3 Mustard Weed)
UseTags6xHis-SUMOExpressionBacterialMutationPromoterAvailable sinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-EGFP-Bin1a
Plasmid#176020PurposeLeishmania cell free expression of zebrafish EGFP-Bin1a. Parton lab clone GRQDepositorInsertBin1a
UseLeishmania cell free expressionTagsEGFPExpressionMutationPromoterAvailable sinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-mCherry-Bin1a
Plasmid#176024PurposeLeishmania cell free expression of zebrafish mCherry-Bin1a. Parton lab clone GSSDepositorInsertBin1a
UseLeishmania cell free expressionTagsmCherryExpressionMutationPromoterAvailable sinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_KLF4
Plasmid#140104PurposeCRISPR-Cas9 library validationDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMutationPromotergRNA1 under U6 and gRNA2 under H1Available sinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB6-Lrig1-T2A-sfGFP-iCre-ERT2-FNF-TK
Plasmid#126651PurposeB6J Lrig1-T2A-sfGFP-iCre-ERT2 allele targeting vector, low copy numberDepositorInsertLrig1 (Lrig1 Mouse)
UseCre/Lox and Mouse TargetingTagsExpressionMutationC-terminal fusion of T2A-sfGFP-iCre-ERT2PromoterAvailable sinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pOst1-pro-alphaf(MUT2)-E2-Crimson
Plasmid#117663PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpOst1-pro-af(MUT2)-E2-Crimson
UseTagsExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only