We narrowed to 128 results for: px459 plasmids
-
Plasmid#192256Purposeexpressing sgRNA-2 targeting eIF3k locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3k locus closed to stop coden (EIF3K Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3k sgRNA-1 PX459 plasmid
Plasmid#192255Purposeexpressing sgRNA-1 targeting eIF3k locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3k locus closed to stop coden (EIF3K Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3f sgRNA-1 PX459 plasmid
Plasmid#192253Purposeexpressing sgRNA-1 targeting eIF3f locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3f locus closed to stop coden (EIF3F Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3f sgRNA-2 PX459 plasmid
Plasmid#192254Purposeexpressing sgRNA-2 targeting eIF3f locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3f locus closed to stop coden (EIF3F Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3b sgRNA-2 PX459 plasmid
Plasmid#192250Purposeexpressing sgRNA-2 targeting eIF3b locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3b locus closed to stop coden (EIF3B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3b sgRNA-1 PX459 plasmid
Plasmid#192249Purposeexpressing sgRNA-1 targeting eIF3b locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3b locus closed to stop coden (EIF3B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)PromoterAvailable sinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)PromoterAvailable sinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459 sgFIP200
Plasmid#175024PurposeCRISPR-Cas9 plasmid targeting exon 3 of human FIP200.DepositorInsertRB1CC1 (RB1CC1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
px459 EQR
Plasmid#101732PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
UseTagsExpressionMammalianMutationVQRPromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459 sgAtg5
Plasmid#175023PurposeCRISPR-Cas9 plasmid targeting exon 2 of human Atg5.DepositorInsertATG5 (ATG5 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgPLXNB2
Plasmid#86151PurposeCas9/CRISPR plasmid for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459_GINS4_gRNA
Plasmid#232734PurposeGenerates GINS4 dTAG C ternimal knock-in cell linesDepositorInsertGINS4 (GINS4 Human)
UseTagsExpressionBacterial and MammalianMutationNOPromoterAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_MCM2_sgRNA
Plasmid#232730PurposeGenerates MCM2 dTAG C ternimal knock-in cell linesDepositorInsertMCM2 (MCM2 Human)
UseTagsExpressionBacterial and MammalianMutationNOPromoterAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_CDC45_sgRNA
Plasmid#232732PurposeGenerates CDC45 dTAG C ternimal knock-in cell linesDepositorInsertCDC45 (CDC45 Human)
UseTagsExpressionBacterial and MammalianMutationNOPromoterAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorInsertGSDMD (GSDMD Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hPKAalpha
Plasmid#185379PurposeFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alphaDepositorInsertPRKACA (PRKACA Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hMYC
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorInsertMYC (MYC Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only