8,086 results
-
Plasmid#122067PurposeExpressing Dhh1-PADepositorInsertDhh1-PA (DHH1 Budding Yeast)
UseTagsPAExpressionYeastMutationAspartic acid 195 to alanine; Glutamic acid 196 t…PromoterAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHES873
Plasmid#87945PurposeExpresses estradiol-inducible synthetic transcription factor in yeast under control of GAL1 promoter. It activates transcription of promoters containing Zif268 binding sites.DepositorInsertpGAL1- Zif268 DBD - hPR LBD - MSN2 AD (PGR Human, Budding Yeast)
UseTagsExpressionYeastMutationPromoterGAL1Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXRA2
Plasmid#63144PurposeADE2 marker pXR vector uses for both plasmid assembly in vivo, as well as targeted genomic integration.DepositorTypeEmpty backboneUseCre/LoxTagsExpressionBacterial and YeastMutationPromoterAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB6684
Plasmid#106154PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6631, integration into Yarrowia lipolytica chromosomal location IntD_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB6631
Plasmid#106161PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6684 into Yarrowia lipolytica chromosomal location IntD_1, amp resistanceDepositorInsertunknown
UseTagsExpressionYeastMutationPromoterAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJAS1668
Plasmid#158593PurposeVioE-ePTS1 CEN6/ARS4DepositorInsertVioE-ePTS1
UseTagsExpressionYeastMutationPromoterAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-zeoCV
Plasmid#73890Purposefission yeast drug selection markerDepositorInsertzeoCV
UseTagsExpressionBacterial, Mammalian, and Y…MutationPromoterCMVAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW1667
Plasmid#112041PurposeCEN/ARS plasmid for GAL-inducible ERG5-V5-TEV-EGFP expression marked with URADepositorInsertERG5
UseTagsV5-TEV-EGFPExpressionYeastMutationPromoterGAL1Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
UseTagsExpressionBacterial and YeastMutationPromoterAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB2875
Plasmid#63640PurposepCfB2875 is a vector for multiple integrations at sites sharing homology with Ty3Cons. The selective marker is Kl.URA3. Additionally it contains a USER cassette.DepositorTypeEmpty backboneUseCre/LoxTagsExpressionYeastMutationPromoternoneAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS414 Hsh155 K410N
Plasmid#87280PurposeEncodes Hsh155 K410N for expression in yeastDepositorInsertHSH155 (HSH155 Budding Yeast)
UseTagsExpressionBacterial and YeastMutationK410NPromoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKH-MoHyPer
Plasmid#78267PurposeExpress HyPer-AS sensor that change excitation wavelength with the presence of hydrogen peroxide.DepositorInsertMoHyper
UseExpress in magnaportheTagsExpressionYeastMutationPromoterRp27Available SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS405 PEX14-VAC8-RFP
Plasmid#166844PurposeExpresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORFDepositorUseTagsPEX14 transmembrane domain and RFPExpressionYeastMutationPEX14 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorUseTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNRB143
Plasmid#36452DepositorAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS415-recR
Plasmid#49457Purposesingle copy recombinase yeast expression plasmidDepositorInsertrecR
UseTagsExpressionYeastMutationPromoterGal1Available SinceNov. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW mKate2-T2A-mTurquoise2
Plasmid#118426PurposeProduces equimolar expression of mKate2 and mTq2DepositorInsertmKate2-T2A-mTq2
UseTagsExpressionYeastMutationPromoterAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCfB2375
Plasmid#67546PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked natMX marker, integration into S. cerevisiae XI-1 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeTagsExpressionYeastMutationPromoterAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only