We narrowed to 222 results for: Cd6
-
Plasmid#109994PurposeProtein expression and purification of PDCD6IP_BRO1DepositorInsertPDCD6IP_BRO1 (PDCD6IP Human)
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
CD63-pEGFP C2
Plasmid#62964Purposefull length human CD63 cloned into pEGFP C2DepositorInsertCD63 molecule (CD63 Human)
TagsEGFPExpressionMammalianMutationCD63 has 1 silent mutation compared to the coding…PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMEH371 CD63 HA
Plasmid#168220PurposeMammalian expression of tetraspanin CD63 fused to a C-terminal HA tagDepositorAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PDCD6_EF-hand
Plasmid#110009PurposeProtein expression and purification of PDCD6_EF-handDepositorInsertPDCD6_EF-hand (PDCD6 Human)
ExpressionBacterialAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_PDCD6IP_ALIX V-domain
Plasmid#178483PurposeBacterial expression of human domain with His-tag and GST tagDepositorInsertPDCD6IP_ALIX V-domain (PDCD6IP Synthetic, Human)
TagsHis-GSTExpressionBacterialPromoterT7/LacOAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGS-CD64-2
Plasmid#109191PurposeEncodes full-length engineered CD64 with C-terminal Twin-Strep tag to be expressed in a baculovirus/insect cell expression systemDepositorInsertFull-length engineered CD64, derived from human CD64
TagsTwin-StrepExpressionInsectMutationengineered for efficient expression, see publicat…PromoterPolyhedrinAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
p67.uni.pA.OTIIp.mHEL.flag.mCMV.PGK.CD63GFP.WPRE
Plasmid#228765PurposemHEL and OT2-peptideDepositorInsertOVA epitope ISQAVHAAHAEINEAGR
ExpressionMammalianAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-pHluorin_M153R-CD63
Plasmid#172117PurposeFluorescent reporter for CD63-positive exosome secretionDepositorInsertCD63 (CD63 Human)
UseLentiviralTagspHluorin_M153R in a small extracelluar loop of CD…ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/CD63mScarlet
Plasmid#182972PurposeStably express CD63 fused with mScarlet in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEH343 CD63 MS2 HA
Plasmid#168217PurposeMammalian expression of tetraspanin CD63 fused to the MS2 dimer and C-terminal HA tagDepositorAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCOM-CD63-COM
Plasmid#138350PurposeExpressing COM-CD63-COM fusion protein in mammalian cellsDepositorInsertCOM-CD63-COM fusion protein
UseCRISPR and LentiviralTagsCOM is fused to the N and C termini of human CD63ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-CD63
Plasmid#194989Purposeoverexpress CD63DepositorInsertGFP-CD63
ExpressionBacterialAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CD63-L7Ae
Plasmid#180503PurposeHuman CD63-L7Ae fusion proteinDepositorInsertHuman CD63-L7Ae fusion protein
ExpressionMammalianPromoterCMVAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL0_154 [pCD6 ORI]
Plasmid#210676PurposeLevel 0 partDepositorInsertpCD6 ORI
UseSynthetic BiologyAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HiBiT-CD63
Plasmid#162591PurposeN-terminally HiBiT-tagged human CD63 under CAG promoterDepositorInserthuman CD63 (CD63 Synthetic, Human, human)
TagsHiBiTExpressionMammalianPromoterCAG promoterAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
p51.SRE.mCMV.CD63-GFP.wpre
Plasmid#226773PurposeCD63-GFP in p52 (SRE backbone)DepositorInsertCD63 (CD63 )
ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CD69-His-bio
Plasmid#52328PurposeExpresses full-length C-type lectin domain family 2 member C ectodomain in mammalian cells. N-terminal His tag, biotinylation sequence and rat Cd4d3+4 tag.DepositorInsertCD69 (CD69 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/GFPCD63
Plasmid#231709PurposeStably express CD63 fused with GFP in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TK-Firefly-cjCD69
Plasmid#122279PurposeLentiviral vector for stable expression of Firefly luciferase.DepositorInsertsFirefly luciferase
cjCD69 3'UTR
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only