We narrowed to 81,735 results for: TRI
-
Plasmid#91683PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN156
Plasmid#91685PurposeExpress sgRNA targeting human ZNF804ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN157
Plasmid#91686PurposeExpress sgRNA targeting human ZNF804ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN118
Plasmid#91645PurposeExpress sgRNA targeting human MPP6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN119
Plasmid#91646PurposeExpress sgRNA targeting human MPP6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN276
Plasmid#91647PurposeExpress sgRNA targeting human PLCH2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN277
Plasmid#91648PurposeExpress sgRNA targeting human PLCH2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN135
Plasmid#91649PurposeExpress sgRNA targeting human SATB2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN125
Plasmid#91650PurposeExpress sgRNA targeting human PPP1R16BDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN128
Plasmid#91651PurposeExpress sgRNA targeting human PTGISDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN129
Plasmid#91652PurposeExpress sgRNA targeting human PTGISDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN204
Plasmid#91655PurposeExpress sgRNA targeting human PTPRFDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN205
Plasmid#91656PurposeExpress sgRNA targeting human PTPRFDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN280
Plasmid#91659PurposeExpress sgRNA targeting human RIMS1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN281
Plasmid#91660PurposeExpress sgRNA targeting human RIMS1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN134
Plasmid#91661PurposeExpress sgRNA targeting human SATB2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN124
Plasmid#91662PurposeExpress sgRNA targeting human PPP1R16BDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN166
Plasmid#91585PurposeExpress sgRNA targeting human CNTN4DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN167
Plasmid#91586PurposeExpress sgRNA targeting human CNTN4DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC84-ScSEIPIN-Ndelta
Plasmid#96985PurposeExpress yeast SEIPIN gene in plants.DepositorInsertScSEIPIN (SEI1 Budding Yeast)
Tags6xHis and GFPExpressionPlantMutationN-terminal 39 nucleotides were deleted from yeast…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS315-PGK-SEIPIN2
Plasmid#96987PurposeExpress GFP-tagged Arabidopsis SEIPIN2 gene in yeast cells.DepositorInsertSEIPIN2 (AT1G29760 Mustard Weed)
ExpressionYeastPromoterPhosphoglycerate Kinase (PGK) promoterAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC84-SEIPIN3N-1C
Plasmid#96983PurposeExpress mutated Arabidopsis SEIPIN1 gene in plants.DepositorInsertSEIPIN1 (AT5G16460 Mustard Weed)
Tags6xHis and GFPExpressionPlantMutationA segment of 507 nucleotides from the N terminus…Promoter35SAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC84-SEIPIN1N-3C
Plasmid#96982PurposeExpress mutated Arabidopsis SEIPIN3 gene in plants.DepositorInsertSEIPIN3 (AT2G34380 Mustard Weed)
Tags6xHis and GFPExpressionPlantMutationA segment of 108 nucleotides from the N terminus…Promoter35SAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-ssp3
Plasmid#86382PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster ssp3 enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-ham
Plasmid#86383PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster ham enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-sgl
Plasmid#86384PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster sgl enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-ncm
Plasmid#86385PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster ncm enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
csd5_41-192/pET28b(+)
Plasmid#83296Purposecsd5, construct: 41-192, pET28b(+) N-tagDepositorInserthp1250
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-40Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
csd4_22-438/pET28b(+)
Plasmid#83295Purposecsd4, construct: 22-438, pET28b(+) N-tagDepositorInserthp1075
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-21Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWHI2-HYG
Plasmid#80589PurposeCEN plasmid expressing full-length WHI2 from S.cerevisiae S288C background under its native promoterDepositorAvailable SinceJuly 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXY029 (mEos2-MTSBs)
Plasmid#72652PurposeInducible expression of mEos2-MTSBs in bacteriaDepositorInsertmEos2-MTSBs
TagsmEos2ExpressionBacterialPromoterT5-lacAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK360
Plasmid#71571PurposeProduces Acetobacter aceti 1023 acetyl-CoA:oxalate CoA-transferase (UctC) with Thr2>Ala mutant (UctC-T2A)DepositorInsertacetyl-CoA:oxalate CoA-transferase
ExpressionBacterialMutationchanges threonine-2 to alaninePromoterT7Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK385
Plasmid#71572PurposeProduces Acetobacter aceti 1023 succinyl-CoA:acetate CoA-transferase with C-terminal His6 tag (AarCH6)DepositorInsertsuccinyl-CoA:acetate CoA-transferase
TagsHis6ExpressionBacterialPromoterT7Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGS1422
Plasmid#63793PurposeVector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal eCitrine Twin-Strep tag followed by URA3 selection markerDepositorInserteCitrine-Twin-tag followed by URA3 selection marker
UseE. coli cloning vectorTagseCitrine-Twin-tagPromoternoneAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Rem2 S69A/S241A/S308A/S334A
Plasmid#51594Purposeexpresses RNAiR myc-tagged Rem2 S-A mutantDepositorInsertRem2 (Rem2 Mouse)
TagsmycExpressionMammalianMutationSerines 69, 241, 308, 334 to Alanines; also RNAi …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRc33_423
Plasmid#49749DepositorInsertAS33_423
UseSynthetic BiologyExpressionBacterialMutationCodon optimized for E.coliPromoterpLuxAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-mMCL1 Delta C22
Plasmid#45820DepositorInsertmMCL-1 Delta C22
ExpressionMammalianMutationC-terminal 22 amino acids are deleted from full l…Available SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-Delta N67-mMCL1
Plasmid#45819DepositorInsertDelta N67-mMCL-1
ExpressionMammalianMutationN-terminus 67 amino acids deleted from full lengt…Available SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFloxin-Ofd1-Myc-KDD359-361FSY
Plasmid#24578DepositorInsertOfd1 (Ofd1 Mouse)
UseCre/Lox and Mouse TargetingTagsMycMutationLysine-Aspartate-Aspartate 359-361 changed to Phe…Available SinceMay 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
Integrin β5-GFP
Plasmid#205090PurposeExpress GFP-tagged human integrin β5 in mammalian cellsDepositorAvailable SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGM6
Plasmid#110660PurposeAdeno-Associated Virus (AAV) serotype 6; contains the AAV6 cap genes, AAV2 rep genes, and adenovirus helper genes. Good for in vivo transduction of muscle, lung, liver and other tissues.DepositorInsertAAV6 cap genes, AAV2 rep genes, adenovirus helper genes
UseAAVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AY22_pgRNA.R5.1
Plasmid#100294PurposeCCR5-targeting gRNA expression plasmidDepositorInsertgRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6 RNA Pol III promoter human snRNAAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUB1 (full-length, aa 1-271)
Plasmid#61420PurposeExpresses human OTUB1 (full-length) in E. coli.DepositorInsertOTUB1 (Ubiquitin thioesterase OTUB1) (OTUB1 Human)
TagsHis6-GST-3CExpressionBacterialPromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-Cezanne (OTU, aa 53-446)
Plasmid#61581PurposeExpresses human Cezanne (OTU domain) in E. coli.DepositorInsertCezanne (OTUD7B Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-52 and aa 447-843.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
PH-Btk-GFP
Plasmid#51463PurposeIs a biosensor for PIP3DepositorAvailable SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1 MOSPD3
Plasmid#226405PurposeExpression of human MOSPD3 fused to EGFP in mammalian cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only