We narrowed to 27,538 results for: GFP
-
Plasmid#63091PurposeContains expanded CGG repeats (99 repeats) within the 5'UTR of FMR1 as found in the Fragile X Tremor Ataxia Syndrome (FXTAS). These repeats are in frame with EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertexpanded CGG repeats (99 repeats) within the 5'UTR of FMR1 (FMR1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Str-KDEL_SBP-EGFP-GPI
Plasmid#65294Purposesynchronize trafficking of EGFP-GPI from the ER (RUSH system)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGPI anchor
TagsEGFP and IL-2 Signal Sequence and Streptavidin Bi…ExpressionMammalianPromoterCMVAvailable sinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-blast shGFP
Plasmid#110419PurposeshGFP control, silence GFP gene, blasticidin selection.DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N1_MeCP2(WT)
Plasmid#110186PurposeExpression of mouse MeCP2 (WT) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMeCP2_e2 FL (mouse cDNA) (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationwild typePromoterCMVAvailable sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP rbFOX1
Plasmid#63085PurposeMammalian expression of EGFP tagged FOX1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRBFOX1 (RBFOX1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p007ampGFP
Plasmid#58535PurposeGFP from jellyfish Aquorea sp. under T5 promoter with lac operators; ampicillin resistant.DepositorPublicationInsertGreen fluorescent protein
ExpressionBacterialPromoterT5 between two lac operatorsAvailable sinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP NFAT5 (no EGFP)
Plasmid#13627DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNFAT5 (NFAT5 Human)
Tags6xMycExpressionMammalianAvailable sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAG426GAL-ccdB-EGFP
Plasmid#14203DepositorPublicationTypeEmpty backboneUseGateway CloningTagsEGFPExpressionYeastAvailable sinceMarch 16, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TrHKII-pGFPN3
Plasmid#21921DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTruncated human HKII cDNA (lacking the sequence encoded by exon 1, which is the mitochondrial binding domain) in pGFP-N3 plasmid (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKII cDNA sequence (l…Available sinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCS2+MCS-P2A-sfGFP
Plasmid#74668PurposePlasmid for expression of wild-type or mutant cDNA fragments (mutation reporter) or complete cDNAs in frame with superfolderGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsfGFP
ExpressionMammalianAvailable sinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-MRLC1 T18D, S19D
Plasmid#35682DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMRLC1 (MYL9 Human)
TagsEGFPExpressionMammalianMutationT18D and S19DPromoterCMVAvailable sinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLv-HSA-uDys/eGFP
Plasmid#26810DepositorInsertdystrophin (DMD Human)
UseLentiviral; Lentiviral plasmid backbone from l. n…TagseGFPMutationdeleted R4-R23 deleted exons 71-78Available sinceSept. 12, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
N1-p18-EGFP
Plasmid#42334DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp18 (LAMTOR1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hCent2-pEGFP-C1
Plasmid#29559DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCent2 (CETN2 Human)
TagsEGFPExpressionMammalianAvailable sinceOct. 7, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-delta90GFP
Plasmid#26645DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdelta90 beta-catenin (Ctnnb1 Mouse)
TagsGFPExpressionMammalianMutationDeletion of first 90 aa of beta cateninAvailable sinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PECAM-eGFP
Plasmid#14688DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPECAM promoter/enhancer (Pecam1 Mouse)
TagsEGFPExpressionMammalianAvailable sinceMay 15, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMRX-No-HaloTag7-mGFP-LC3
Plasmid#184901PurposeStable expression of HaloTag7-mGFP-LC3 in mammalian cells to measure autophagic fluxDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLC3B
TagsHaloTag7 and monomeric EGFPExpressionMammalianAvailable sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP
Plasmid#24033DepositorAvailable sinceFeb. 24, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFPC1-muscle Amphiphysin 2
Plasmid#22213DepositorAvailable sinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by