We narrowed to 14,497 results for: SHR;

#186837

knock out KEAP1 in mammalian cells

Boyi Gan

Koppula et al Nat Commun. 2022 Apr 22;13(1):2206. doi:

Aug. 31, 2022

Academic Institutions and Nonprofits only

#128338

pAAV encoding gRNA sequence for loss-of-function indels

Ryan Drenan

Peng et al Eur J Neurosci. 2018 May 19. doi: 10.111

July 19, 2019

Academic Institutions and Nonprofits only

#140650

BRD4 tagging with mAID

Masato Kanemaki

Yesbolatova et al Nat Commun. 2020 Nov 11;11(1):5701. doi:

Nov. 12, 2020

Academic Institutions and Nonprofits only

#107614

N-terminal half of π-EB1 with wild-type LOV2, no fluorescent tag

Torsten Wittmann

van Haren et al Nat Cell Biol. 2018 Jan 29. pii: 10.1038

April 30, 2018

Academic Institutions and Nonprofits only

#223698

gRNA control for dPspCas13b-FTO

Chuan He

Wei et al Science. 2022 May 27;376(6596):968-973.

Aug. 20, 2024

Academic Institutions and Nonprofits only

#80008

gRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.

Sriram Neelamegham

Stolfa et al Sci Rep. 2016 Jul 26;6:30392. doi: 10.10

July 25, 2016

Academic Institutions and Nonprofits only

#85995

One-guide Perturb-seq vector backbone; modified bovine U6 promoter; original constant region

Jonathan Weissman

Adamson et al Cell. 2016 Dec 15;167(7):1867-1882.e21.

Feb. 14, 2017

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#136584

Expresses an inducible short hairpin targeting human NRF2 sequence

Kevin Janes

Pereira et al Sci Signal. 2020 Apr 14;13(627). pii: 13

June 13, 2020

Academic Institutions and Nonprofits only

#69112

For mammalian expression of knockdown-proof human ch-TOG tagged with EGFP.

Stephen Royle

Gutierrez-Caballero et al Biol Open. 2015 Jan 16;4(2):170-9. doi:

Oct. 13, 2015

Academic Institutions and Nonprofits only