We narrowed to 10,749 results for: AGA
-
Plasmid#131490PurposeEndogenous tagging of GluA2: C-terminal (amino acid position: STOP codon)DepositorUseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianMutationPromoterCBh and U6Available sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST EGFP-flag-CAD
Plasmid#188118PurposeExpresses N-terminal EGFP-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsEGFP tag and Flag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…PromoterAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338462
Plasmid#78158PurposeshXPO1 targeting CDSDepositorInsertXPO1 (XPO1 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterhU6 and hU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001149093)
Plasmid#77788Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorInsertMAPK1 (MAPK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorInsertsgTP53-2 (TP53 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001162212)
Plasmid#76310Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only