We narrowed to 2,340 results for: CO
-
Plasmid#79712PurposeThis plasmid encodes the kinase domain of E2AK2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CFP(1-158)-RGS7t
Plasmid#55761PurposeAn amino-terminal CFP Fragment was fused to residues 202-477 of RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertRGS7(202-477)-CFP(1-158) (RGS7 Aequorea victoria, Human)
TagsCFP(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationThe RGS sequence amino terminal to the GGL domain…PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCh-LgBiT-2A-EGFP-Vin-PILATeS-CT
Plasmid#216763PurposePiggyBac vector for stable co-expression of mCherry-LgBiT and EGFP-Vinculin-PILATeS-CT (700 pM) negative control in mammalian cells. Requires transposaseDepositorInsertmCherry-LgBiT-P2A-T2A-EGFP-Vin-PILATeS-CT
TagsEGFP and mCherryExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CaMKIIa-mScarlet-I-P2A-2M-Qt-FLAG
Plasmid#206956PurposeAAV plasmid for CaMKIIa driven co-expression of mScarlet-I and 2M-Qt-FLAG EMcapsulinsDepositorInsertmScarlet-I, MmMT3, QtEnc
UseAAVTagsFLAGAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST-AUP1 379-410:Ube2G2
Plasmid#185335PurposeUsed for co-expression of the AUP1 G2BR with UBE2G2 for crystallographyDepositorAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2AmCherry-W
Plasmid#163177PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-F8-TAG-C105A
Plasmid#122478Purposeexpresses human IFITM3-C105A with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
TagsHAExpressionMammalianMutationChanged Phenylalanine 8 to amber codon, cysteine …Available SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-V93-TAG
Plasmid#122479Purposeexpresses human IFITM3 with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-F8-TAG-C71A
Plasmid#122476Purposeexpresses human IFITM3-C71A with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
TagsHAExpressionMammalianMutationChanged Phenylalanine 8 to amber codon, cysteine …Available SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-APLP1ICD-IRES-hrGFP
Plasmid#107546PurposeAAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cellsDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-1 in pcDNAI/Amp
Plasmid#55615PurposeAn amino-terminal CFP fragment was fused to Ggamma-1. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-1 (GNGT1 Bovine, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55616PurposeAn amino-terminal CFP fragment was fused to Ggamma-2. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP (1-158)-gamma-2 (Gng2 Aequorea victoria, Mouse)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-10 in pcDNAI/Amp
Plasmid#55192PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-10. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP-(159-238)-gamma-10 (GNG10 Aequorea victoria, Human)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-12 in pcDNAI/Amp
Plasmid#55194PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-12. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-12 (GNG12 Aequorea victoria, Human)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-miR-125b-1
Plasmid#58989PurposeMSCV based expression vector - co-expresses HcRed and human miR-125b-1DepositorInsertsUseRetroviralExpressionMammalianPromoterMSCVAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND1(T286A)-IRES-mCherry
Plasmid#172639PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1(T286A) and mCherry in mammalian cellsDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTags2xFLAG-2xSTREPExpressionMammalianMutationThr286AlaPromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND1(P287S)-IRES-mCherry
Plasmid#172635PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1(P287S) and mCherry in mammalian cellsDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTags2xFLAG-2xSTREPExpressionMammalianMutationPro287SerPromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only