We narrowed to 77,447 results for: Rest
-
Plasmid#108213PurposeHLA-A0201 his taggedDepositorInsertmajor histocompatibility complex, class I, B (HLA-A Human)
UseEntry vector for gateway systemTagshisAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RBM45_WT
Plasmid#82892PurposeGateway Donor vector containing RBM45, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-mCherry-sspB
Plasmid#121968PurposeExpresses fusion of disordered protein BRD4(462-1362), fluorescent protein mCherry, and sspB which upon light activation binds to iLID.DepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsmCherry-sspBExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV[Tet]-Puro-TRE3G>mMyod1[NM_010866.2]
Plasmid#184380PurposeThe mouse Myod1 gene is expressed under a doxcycline-inducible TRE3G promoterDepositorInsertMyod1 (Myod1 Mouse)
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCC1_STOP
Plasmid#221423PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertABCC1 (ABCC1 Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
JUP_pLX307
Plasmid#98347PurposeLentiviral expression of JUPDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pErCas12a EZ Clone
Plasmid#132641PurposeExpresses ErCas12a and an sgRNA to target a region of interestDepositorInsertErCas12a
UseAAV and CRISPRTags3x HA and SV40 NLSExpressionMammalianMutationQ926R (Please see depositor comments) and BsaI si…PromoterCMV PromoterAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ANLN
Plasmid#183834PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertANLN homology arms with mNeonGreen-linker (ANLN Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
TUBG1_pLX307
Plasmid#98376PurposeLentiviral expression of TUBG1DepositorAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-PC1-3HA
Plasmid#108406PurposeCan be used to generate stable Flp-In cells with tetracycline-inducible human PC1 expression.DepositorAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SMURF2_WT
Plasmid#82259PurposeGateway Donor vector containing SMURF2 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-1
Plasmid#246017PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-2
Plasmid#246018PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
ALCAM-p2A-E2Crimson
Plasmid#83939PurposeLentiviral vector expressing ALCAM-p2A-E2CrimsonDepositorAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDK9_pLX307
Plasmid#98324PurposeLentiviral expression of CDK9DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-li-p33_RS-CLIP
Plasmid#104634PurposeHuman Invariant chain with a CLIP replacement with in frame restriction sites (KpnI/XhoI)DepositorInsertmodified Invariant chain p33 (CD74 Human)
UseEntry vector for gateway systemTagsnoneMutationCLIP domain was replaced by 2 restriction sitesAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_WNT5A_WT
Plasmid#82240PurposeGateway Donor vector containing WNT5A , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSecTaq2-hGas6-Myc-6xHis
Plasmid#226523PurposeExpresses TAM Receptor Ligand human GAS6DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 (NT17)
Plasmid#49085PurposeExpresses human NKCC1 with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RHEB_WT
Plasmid#81257PurposeGateway Donor vector containing RHEB , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PKIA_WT
Plasmid#82153PurposeGateway Donor vector containing PKIA , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
LIMD1_pLX307
Plasmid#98349PurposeLentiviral expression of LIMD1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGMC00035 (aka pMG0784)
Plasmid#210768PurposeLentiviral vector to express human ADRM1DepositorAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TRAF5_WT
Plasmid#82167PurposeGateway Donor vector containing TRAF5 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGFRdn
Plasmid#80431PurposeExpression of a dominant-negative FGFR1 with a nuclear EGFP reporter in chick embryosDepositorInsertFibroblast growth factor receptor 1 (FGFR1 Chicken)
TagsEGFPExpressionMammalianMutationcontains aa 1–425Promoterbeta-actin promoterAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV.EF1α.mEmerald.CD9.miR9T
Plasmid#170452PurposeLentiviral plasmid that encodes mEmerald-CD9 fusion protein with microRNA 9 tandem cassette to restrict expression to microglia with EF1-alpha promoter.DepositorAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
DDX39B_pLX307
Plasmid#98331PurposeLentiviral expression of DDX39BDepositorInsertDDX39B (DDX39B Human)
UseLentiviralTagsV5ExpressionMammalianMutationS296PPromoterE1FaAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMP71-HLA-B0702-His
Plasmid#104850PurposeHLA-B0702 his taggedDepositorInsertmajor histocompatibility complex, class I, B (HLA-B Human)
UseRetroviralTagshisExpressionMammalianPromoterLTRAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only