We narrowed to 874 results for: PX330
-
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG
Plasmid#79877PurposeFLAGless construct expressing high specificity eSpCas9(1.1). Px330-like plasmid.DepositorTypeEmpty backboneUseCRISPRTagsUntagged eSpCas9(1.1)ExpressionMammalianPromoterCBhAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)
Plasmid#71814PurposeExpresses high specificity SpCas9. Px330-like plasmid.DepositorHas ServiceCloning Grade DNAInsertenhanced specificity Cas9 (1.1)
UseCRISPRTags3xFLAGExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1pr_v2-RT
Plasmid#97088PurposeEncodes a HR repair template for knock-in a YFP expression cassette at the promoter of human NEAT1 gene. Best used with px330-NEAT1pr_v2 vector, but also works with px330-NEAT1pr_v1.DepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
HeFm2SpCas9
Plasmid#92111PurposeExpression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence)DepositorInsert“Highly enhanced Fidelity” mut2 SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_NPM1_G6
Plasmid#178091PurposeExpresses the NPM1 G6 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with NPM1_mNeonGreen_Donor to tag NPM1 with mNeonGreen. pX330-like plasmid.DepositorInsertNPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HeFSpCas9
Plasmid#92355PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
HeFm1SpCas9
Plasmid#92110PurposeExpression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRNF219.1.0-gDNA
Plasmid#132464PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRNF219
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTACR TH1-p2aGFP
Plasmid#135815PurposeCRISPR based on px330 p2aGFP targeting TH gene near stop codonDepositorInsertTH 1 guide
UseCRISPRTagsp2a Myr-eGFPAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTACR TH2-p2aGFP
Plasmid#135816PurposeCRISPR based on px330 p2aGFP targeting TH gene near stop codonDepositorInsertTH 2 guide
UseCRISPRTagsp2a Myr-eGFPAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSOX11.1.0-gDNA
Plasmid#176378PurposeExpresses spCas9 and gRNA sequence targeting SOX11DepositorInsertSOX11 gRNA
UseCRISPRAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBACH2.2.0-gDNA
Plasmid#176375PurposeExpresses spCas9 and gRNA sequence targeting BACH2DepositorInsertBACH2 gRNA
UseCRISPRAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSOX2.1.0-gDNA
Plasmid#176382PurposeExpresses spCas9 and gRNA sequence targeting SOX2DepositorInsertSOX2 gRNA
UseCRISPRAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRERF1.1.0-gDNA
Plasmid#176384PurposeExpresses spCas9 and gRNA sequence targeting TRERF1DepositorInsertTRERF1 gRNA
UseCRISPRAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF627.1.0-gDNA
Plasmid#176383PurposeExpresses spCas9 and gRNA sequence targeting ZNF627DepositorInsertZNF627 gRNA
UseCRISPRAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOSR1.1.0-gDNA
Plasmid#176381PurposeExpresses spCas9 and gRNA sequence targeting OSR1DepositorInsertOSR1 gRNA
UseCRISPRAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF608.2.0-gDNA
Plasmid#176380PurposeExpresses spCas9 and gRNA sequence targeting ZNF608DepositorInsertZNF608 gRNA
UseCRISPRAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOU6F1.1.0-gDNA
Plasmid#176377PurposeExpresses spCas9 and gRNA sequence targeting POU6F1DepositorInsertPOU6F1 gRNA
UseCRISPRAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZC3H10.1.0-gDNA
Plasmid#176385PurposeExpresses spCas9 and gRNA sequence targeting ZC3H10DepositorInsertZC3H10 gRNA
UseCRISPRAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZIC3.1.0-gDNA
Plasmid#176379PurposeExpresses spCas9 and gRNA sequence targeting ZIC3DepositorInsertZIC3 gRNA
UseCRISPRAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTX2.1.0-gDNA
Plasmid#176376PurposeExpresses spCas9 and gRNA sequence targeting OTX2DepositorInsertOTX2 gRNA
UseCRISPRAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNR2E3.1.0-gDNA
Plasmid#176386PurposeExpresses spCas9 and gRNA sequence targeting NR2E3DepositorInsertNR2E3 gRNA
UseCRISPRAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHB.1.0-gDNA
Plasmid#132453PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPHB
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF668.1.0-gDNA
Plasmid#132463PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF668 (ZNF668 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCENPBD1.1.0-gDNA
Plasmid#132460PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCENPBD1 (CENPBD1 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTHAP7.1.0-gDNA
Plasmid#132439PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTHAP7 (THAP7 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTOX.1.0-gDNA
Plasmid#132470PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTOX (TOX Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF132.1.0-gDNA
Plasmid#132468PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF132 (ZNF132 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSOX13.1.0-gDNA
Plasmid#132466PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertSOX13 (SOX13 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHTF2.1.0-gDNA
Plasmid#132465PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPHTF2 (PHTF2 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRHOXF2B.1.0-gDNA
Plasmid#132462PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRHOXF2B (RHOXF2B Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRFX7.1.0-gDNA
Plasmid#132455PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRFX7 (RFX7 Human)
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF830.1.0-gDNA
Plasmid#132450PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF830 (ZNF830 Human)
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only