We narrowed to 167,150 results for: Gene
-
Plasmid#24664DepositorInsertmCherry
ExpressionBacterialAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRC3EGFP
Plasmid#193790PurposeExpresses EGFP under the control of PR promoter, p15A origin of replication, Chloramphenicol selectionDepositorInsertEGFP
ExpressionBacterialPromoterPR promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEIAV-SIN6.1 CBLacZ-LucWm1A
Plasmid#44167DepositorInsertsLacZ
firefly luciferase
UseLentiviral and LuciferasePromoterCB, CMV enhancer/chicken beta-actin promoterAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAL3
Plasmid#114673PurposeT7 vector having very low basal expression of target protein can clone and express almost any gene. Asymmetric ligation clones as many as 3 genes simultaneously for co-expression from the same mRNA.DepositorTypeEmpty backboneTagsoptional Ser-Gly-6HisExpressionBacterialPromoterT7Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
Nkx6.2
Plasmid#15542DepositorAvailable SinceAug. 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCHERRY8
Plasmid#24663DepositorInsertmCherry
ExpressionBacterialAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
orthodenticle
Plasmid#37285DepositorInsertorthodenticle (oc Fly)
ExpressionBacterialAvailable SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pST-KNarK2
Plasmid#44565Purposefor ectopic hypoxia inducible expression of mycobacterial proteinsDepositorTypeEmpty backboneUseE.coli-mycobacteria shuttle vectorTagsFlag tag and His tagExpressionBacterialAvailable SinceOct. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCR4-MBII52-probe
Plasmid#67647Purposeantisense RNA probe for RNase protection or nothernDepositorInsertMBII52 snoRNA (Snord115 Mouse)
UseFor in vitro transcriptionAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)MBII85
Plasmid#67643PurposeMBII85 snoRNA expression cassett, contains snoRNA in natural intron surrounded by natural exons.DepositorInsertMBII85 snoRNA
ExpressionMammalianAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L4-pTF-L1R
Plasmid#45954DepositorInsertpTF promoter
UseGateway donor vectorPromoterTET optimizedAvailable SinceAug. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
Crimson/P2A-NLS/HA-HumBeta (pSLIK2)
Plasmid#113857PurposeFor Doxycycline-inducible expression of Humanized Beta synaptase gene, with red fluorescent protein gene E2-Crimson-P2A-Humanized Beta synaptase geneDepositorInsertHumanized Beta
UseLentiviralTagsP2A/CrimsonMutation"humanized" Beta geneAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG Caronte (CT#304)
Plasmid#13860DepositorAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
psbA2-PHLS (b)
Plasmid#52307PurposeReplaces the psbA2 gene in Synechocystis with the PHLS geneDepositorInsertsbeta-phellandrene synthase
Chloramphenicol resistance
UseSynthetic BiologyExpressionBacterialPromoterpsbA2Available SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR-4 porcupine (genomic DNA)
Plasmid#37376DepositorInsertporcupine (por Fly)
ExpressionInsectAvailable SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBS ZfHoxd3a
Plasmid#27534DepositorInsertHoxd3a (hoxd3a Zebrafish)
UseCloning vectorAvailable SinceFeb. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
RCAS (A) Caronte (CT#382)
Plasmid#13862DepositorInsertCaronte (CER1 Chicken)
UseRetroviral; Avian expressionAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBS Caronte (CT#88)
Plasmid#13859DepositorInsertCaronte (CER1 Chicken)
ExpressionBacterialAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pCas9
Plasmid#238032PurposeEncodes Cas9 (ssrA degradation-tagged) under a tetracycline promoter (pTet) on a low-copy replication origin (SC101) as part of the ADEPT system.DepositorInsertspCas9
UseSynthetic BiologyTagsssrAPromotertetAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp1
Plasmid#238034PurposeEncodes sfGFPunder lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-CG10011_C
Plasmid#146027PurposeInsect Expression of CG10011-3UTRDepositorInsertCG10011-3UTR (CG10011 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-CG3077_A
Plasmid#145868PurposeInsect Expression of CG3077-3UTRDepositorInsertCG3077-3UTR (CG3077 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj20
Plasmid#173150PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj20 (si:ch211-113j13.2 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj12b
Plasmid#173142PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj12b (kcnj12b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj14
Plasmid#173144PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj14 (kcnj14 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj19a
Plasmid#173148PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19a (kcnj19a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj19b
Plasmid#173149PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19b (kcnj19b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj21
Plasmid#173151PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj21 (zgc:162160 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 endAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2a
Plasmid#173127PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2a (kcnj2a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2b
Plasmid#173128PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2b (kcnj2b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj3b
Plasmid#173130PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj3b (kcnj3b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj4
Plasmid#173131PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj4 (kcnj4 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj9
Plasmid#173135PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj9 (kcnj9 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10a
Plasmid#173137PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10a (kcnj10a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10b
Plasmid#173138PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10b (LOC100329607 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj11l
Plasmid#173140PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj11l (kcnj11l Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUS250
Plasmid#198322PurposeCumate-inducible gene expression in diverse gram negative bacteria. Features also include mobilisation via oriT, a gigantic multiple cloning site, and blue/white screening via amilCP chromoproteinDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromotercumate-inducibleAvailable SinceApril 12, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS26
Plasmid#32295DepositorTypeEmpty backboneUseBacterial gene additionExpressionBacterialPromoterrhaBAvailable SinceSept. 26, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
p(+)MV-NSE-FlagrP-3g_haP-F497A-3p
Plasmid#58799PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497A gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
TagsFlag and HaPromoterT7Available SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMG207
Plasmid#39273DepositorTypeEmpty backboneUseE coli gene targetingAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
p(+)MV-NSE-FlagrP-3g_haP-F497D-3p
Plasmid#58800PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497D gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
TagsFlag and HaPromoterT7Available SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOTag2T-crelox-PUR
Plasmid#24026DepositorTypeEmpty backboneUseCre/LoxAvailable SinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag2T-crelox-HYG
Plasmid#24025DepositorTypeEmpty backboneUseCre/LoxAvailable SinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only