We narrowed to 14,145 results for: TIM
-
Plasmid#231653PurposeExpresses human ZDHHC4 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Flag-ZDHHC15
Plasmid#231663PurposeExpresses human ZDHHC15 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC2
Plasmid#231512PurposeExpresses human ZDHHC2 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC22
Plasmid#231670PurposeExpresses human ZDHHC22 proteinDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein
Plasmid#215698PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-E2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-E2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNAintron-CHIKV-Structural polyprotein with Nluc tagged E2
Plasmid#215699PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-NLucE2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-NLucE2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
P32m
Plasmid#120943PurposeMoClo golden gate assembly AB part for PlacO (common LacI-repressed promoter; see DOI: 10.1126/science.1256272). Please see Supplemental Documents for annotated Genbank file.DepositorInsertPlacO (Tim Lu, Matt Bennett, etc)
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC3
Plasmid#231652PurposeExpresses human ZDHHC3 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC7
Plasmid#231656PurposeExpresses human ZDHHC7 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC21
Plasmid#231669PurposeExpresses human ZDHHC21proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-GP78
Plasmid#231689PurposeExpresses human GP78 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC9
Plasmid#231658PurposeExpresses human ZDHHC9 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC17
Plasmid#231665PurposeExpresses human ZDHHC17proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC18
Plasmid#231666PurposeExpresses human ZDHHC18 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC8
Plasmid#231657PurposeExpresses human ZDHHC8 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC23
Plasmid#231671PurposeExpresses human ZDHHC23 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC9-C169S
Plasmid#231673PurposeExpresses human ZDHHC9-C169S proteinDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-HAVCR1-COMP5AP-AviTag-9xHis
Plasmid#157276PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-HAVCR1-Fc(DAPA)-AviTag-6xHis
Plasmid#156712PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertHAVCR1 (HAVCR1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR241
Plasmid#240644PurposeExpression of AmNeonGreen-13myc in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
UseGene expression and genomic integration in fishTags13mycMutationCodon-optimized for Exaiptasia diaphana, amino ac…Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI
Plasmid#50723Purposeoverexpression of human TPI1 in E.coliDepositorAvailable SinceJan. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI
Plasmid#50719Purposeexpression of human TPI1 in yeastDepositorAvailable SinceJan. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Ile170Val
Plasmid#50720Purposeexpression of the human TPI Ile170Val allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationIsoleucine 170 to ValinePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Ile170Thr
Plasmid#50721Purposeexpression of the human TPI Ile170Thr allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationIsoleucine 170 to ThreoninePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAL190
Plasmid#22279PurposeExpresses Tim DH-PH domains fused to mYFP-PIF6, for optogenetic recruitmentDepositorInsertTimDHPH-20aaLinker-mYFP-PIF6APB (PIL2 Mustard Weed)
UseSynthetic BiologyExpressionMammalianPromoterSV40Available SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Lys13Arg
Plasmid#50726Purposeoverexpression of the human TPI1 Lys13Arg allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Lysine 13 to ArgeninePromoterT7Available SinceFeb. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
p3.2mar-GFP
Plasmid#63694Purpose3.2 kb marine armor plate enhancer driving GFP reporterDepositorInsert3.2 kb marine stickleback armor plate enhancer
TagsEGFPExpressionMammalianPromoterhsp70Available SinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Ile170Val
Plasmid#50724Purposeoverexpression of the human TPI1 Ile170Val allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Isoleucine 170 to ValinePromoterT7Available SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Lys13Arg
Plasmid#50722Purposeexpression of the human TPI Lys13Arg allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationchanged Lysine 13 to ArgeninePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Ubc-iRFP670-24xMS2-24xPP7
Plasmid#238916PurposeContains Ubc promoter expressing iRFP670 mRNA taged 24xMS2 motif and 24xPP7 motifDepositorInsertiRFP670-24xMS2-24xPP7
UseLentiviralExpressionMammalianPromoterUbcAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Ile170Thr
Plasmid#50725Purposeoverexpression of the human TPI1 Ile170Thr allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Isoleucine 170 to ThreoninePromoterT7Available SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…MutationCodon-optimized for Exaiptasia diaphana, amino ac…Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TPI in pCW57_tTA_Blast
Plasmid#154209PurposeDox-off lentivirus construct all-in-one vector, with Blast resistance, for expression of TPIDepositorInsertTPI1 (TPI1 Human)
UseLentiviralTagsNoneExpressionMammalianPromoterTRE repeats (dox off)Available SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
TPI-PTC160
Plasmid#130698PurposeExpresses TPI-PTC160 NMD reporter (It has a Premature termination codon (PTC) at 160th Amino acid)DepositorAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
TPI-PTC1
Plasmid#130699PurposeExpresses TPI-PTC1 NMD reporter (It has a Premature termination codon (PTC) at First Amino acid)DepositorAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_PTC160-xrRNA-4H
Plasmid#108369PurposeExpresses TPI reporter with premature termination codon (PTC160); enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertPTC160 TPI reporter with MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianMutationPTC160PromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-xrRNA-4H
Plasmid#108368PurposeExpresses wild type TPI reporter; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertWild type TPI reporter with MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-TPI_PTC160-xrRNA-4H
Plasmid#108378PurposeFRT integration of TPI reporter with premature termination codon (PTC160); enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertPTC160 TPI reporter with MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-TPI_WT-xrRNA-4H
Plasmid#108377PurposeFRT integration of wild type TPI reporter; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertWild type TPI reporter with MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3.2mar(T->G)-GFP
Plasmid#63695Purpose3.2 kb marine armor plate enhancer with a single T->G bp change driving GFP reporterDepositorInsert3.2 kb marine stickleback armor plate enhancer with a single T->G base pair change
TagsEGFPExpressionMammalianMutationT->G bp changePromoterhsp70Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-msfGFP
Plasmid#194913PurposeTetracycline inducible expression of msfGFP in StaphylococciDepositorInsertShine Dalgarno Sequence followed by monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
NG0886 pCI-TPI-WT-4H
Plasmid#65801PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianPromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
HP21-TPI-WT-no_introns
Plasmid#131044PurposeExpresses TPI-Wildtype NMD reporter without introns and with a 21 nt hairpin in 5'UTRDepositorAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
NG0750 pCI-TPI-PTC48-4H
Plasmid#65803PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
HP21-TPI-PTC1
Plasmid#131043PurposeExpresses TPI-PTC1 NMD reporter (It has a Premature termination codon (PTC) at First Amino acid) with a 21 nt hairpin in 5'UTRDepositorAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
NG1237 pCI-TPI-PTC160-4H
Plasmid#65804PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianMutationpremature stop codon at 160PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-xrRNA-4MS2-4H
Plasmid#108370PurposeExpresses wild type TPI reporter; enables detection of 5'-3' decay intermediates (xrFrag); 4MS2 tethering sites downstream of xrRNA and allows detection via northern blot (4H binding sites)DepositorInsertWild type TPI reporter with 4MS2 binding sites downstream of MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-4MS2-xrRNA-4H
Plasmid#108371PurposeExpresses wild type TPI reporter; enables detection of 5'-3' decay intermediates (xrFrag); 4MS2 tethering sites upstream of xrRNA and allows detection via northern blot (4H binding sites)DepositorInsertWild type TPI reporter with 4MS2 binding sites upstream of MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
NG0888 pCI-TPI-PTC48-HBB
Plasmid#65802PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
TagsHBB (beta-globin 3'UTR for probe binding)ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only