We narrowed to 305 results for: IPTG
-
Plasmid#224586PurposeIPTG-inducible phage φX174 lysis gene EDepositorInsertphage φX174 lysis gene E (phiX174p08 )
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPA1lacO-1Available sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT
Plasmid#26106PurposeSGC Empty backbone for bacterial expressionDepositorTypeEmpty backboneUseTags6xHis, TEV cleavage site, and TrxAExpressionBacterialMutationPromoterT7-lacO (lactose/IPTG inducible)Available sinceDec. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)::NL
Plasmid#141289PurposeNLUC in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertNLUC
UseLuciferaseTagsExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTD-NTwinStrep_Sm
Plasmid#45937Purposeuse to create N-terminal Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal Twin-Strep-tag and C-terminal 6x His-tagDepositorTypeEmpty backboneUseTags6xHis and Twin-StrepExpressionBacterialMutationPromoterTrc (lactose/IPTG inducible)Available sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTD-NTwinStrep_Km
Plasmid#45938Purposeuse to create N-terminal Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal Twin-Strep-tag and C-terminal 6x His-tagDepositorTypeEmpty backboneUseTags6xHis and Twin-StrepExpressionBacterialMutationPromoterTrc (lactose/IPTG inducible)Available sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)::NL3F10H
Plasmid#141290PurposeNLUC:3xFlag:10xHis in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertNLUC3F10H
UseLuciferaseTagsFlag (x3) and His (x10)ExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NR
Plasmid#89625PurposeExpresses recombinant 6HIS tagged T. cruzi nitrate reductase in E. coli upon IPTG inductionDepositorInsertNitrate reductase
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMGA-ptac-sfGFP
Plasmid#139934PurposeIPTG-inducible sfGFP expression on M. magneticum/E. coli shuttle vectorDepositorInsertLacI-Ptac-sfGFP
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFW2100
Plasmid#224212PurposeBacteroides genomic editing tool; IPTG inducible-Fncpf1DepositorInsertFncpf1
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET11a-Z-NGFP
Plasmid#52734PurposeIPTG-inducible expression of Z-NGFP positive control for in vivo split GFP assembly assayDepositorInsertNGFP+Z-fusion
UseTagsHis tagExpressionBacterialMutationPromoterT7Available sinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
DT044A
Plasmid#159405PurposeInducible Perfringolysin O (PFO) expression and purification, controlled under hybrid IPTG-regulated T7/LacO promoter (pRT30)DepositorInsertpr.T7-LacO-6xHis-PFO (Pfo, Clostridium perfringens)
UseSynthetic BiologyTags6xHisExpressionBacterialMutationPromoterT7/LacO promoterAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_K3AK4A
Plasmid#202585PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the K3A and K4A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purification with a minimal scarDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Lysine 3 to Alanine, changed ORF1p …PromoterAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKPY514
Plasmid#62598PurposeEncodes Thr251Gly-EcPheRS Under IPTG-Inducible (PT5) ControlDepositorInsertThr251Gly-EcPheRS
UseTags6xHisExpressionBacterialMutationThr251GlyPromoterT5Available sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21a - GR
Plasmid#89614PurposeExpresses recombinant 6HIS tagged T. cruzi Glutathione reductase protein in E. coli upon IPTG inductionDepositorInsertGlutaredoxin
UseTags6HISExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAAA
Plasmid#202587PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A, E92A, and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…PromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…PromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a - TryX
Plasmid#89623Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi tryparedoxin protein in E. coli upon IPTG inductionDepositorInsertTryparedoxin
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase
Plasmid#87741PurposeIPTG-inducible expression of T4 DNA ligase for protein purificationDepositorInsertT4 DNA ligase (30 )
UseTags6xHisExpressionBacterialMutationPromoterT5-lacAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only