We narrowed to 9,362 results for: CAG
-
Plasmid#219897PurposeThe base plasmid of TUNEYALI for TF32DepositorInsertContains gRNA targeting TF32 (YALI1_F33301g) and homologous arm matching TF32
ExpressionYeastAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13227
Plasmid#219902PurposeThe base plasmid of TUNEYALI for TF37DepositorInsertContains gRNA targeting TF37 (YALI1_D01890g) and homologous arm matching TF37
ExpressionYeastAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13240
Plasmid#219913PurposeThe base plasmid of TUNEYALI for TF50DepositorInsertContains gRNA targeting TF50 (YALI1_F21426g) and homologous arm matching TF50
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13192
Plasmid#219867PurposeThe base plasmid of TUNEYALI for TF02DepositorInsertContains gRNA targeting TF02 (YALI1_D21702g) and homologous arm matching TF02
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13201
Plasmid#219876PurposeThe base plasmid of TUNEYALI forTF11DepositorInsertContains gRNA targeting TF11 (YALI1_E11341g) and homologous arm matching TF11
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13215
Plasmid#219890PurposeThe base plasmid of TUNEYALI for TF25DepositorInsertContains gRNA targeting TF25 (YALI1_B18134g) and homologous arm matching TF25
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13248
Plasmid#219919PurposeThe base plasmid of TUNEYALI for TF58DepositorInsertContains gRNA targeting TF58 (YALI1_F37742g) and homologous arm matching TF58
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_1st-hU6-sgNT
Plasmid#177212PurposeExpresses a Sik1-targeting (mU6) and non-targeting (hU6) gRNAs, and Cre-recombinaseDepositorInsertsgSik1_1st/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTOX.1.0-gDNA
Plasmid#132470PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTOX (TOX Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_PBX2_1
Plasmid#72357PurposeEncodes gRNA for 3' target of human PBX2 along with Cas9 with 2A GFPDepositorInsertPBX2 (PBX2 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pLXIN2-RFP
Plasmid#99205PurposeRFP expressing bicistronic retroviral vectorDepositorInsertRed fluorescent protein
UseRetroviral; Bicistronic retroviral expression vec…ExpressionMammalianMutationThe dsRed cDNA was PCR amplified off AddGene plas…Available SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135979PurposegRNA against the left loxP site of the Ai9 alleleDepositorInsertAi9 gRNA1
UseAAV, CRISPR, and Mouse TargetingTagsHAPromoterU6Available SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ15-PB-U6-Nkx6.1-acti-gRNA1
Plasmid#131059PurposeActivation of NKX6.1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Template
Plasmid#240291PurposeKI:Actb Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Template
Plasmid#240295PurposeKI:Sptbn4 Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Gria1 Donor;3xV5 KO;Template
Plasmid#240293PurposeKI:Gria1 Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Gria1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#2
Plasmid#240308PurposeDonor:smFP-V5 KO:Gphn#2DepositorInsertKO gRNAs for Gphn
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS-mak10 gRNA
Plasmid#160385PurposeExpresses guide RNA for targeting MAK10 in yeastDepositorInsertmak10 gRNA
ExpressionYeastPromoterRNA pol III promoter (tRNA-Tyr)Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int3
Plasmid#188683Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPATZ1 (PATZ1 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZFPM2.1.0-gDNA
Plasmid#132459PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZFPM2 (ZFPM2 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac4
Plasmid#126884PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Rac4
Plasmid#126896PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ OBfold
Plasmid#126901PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ OBfold
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_1
Plasmid#126894PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-BFP)
Plasmid#217305PurposesgRNA BFP + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-BFP
UseCRISPR and Synthetic BiologyPromoterU6, Ef1alphaAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLexm
Plasmid#99844Purposemammalian expressionDepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHes1-DsRed
Plasmid#13767DepositorInsertHes1 promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNrl-DsRed
Plasmid#13764DepositorInsertNrl promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-GFP-T(WT)
Plasmid#181736Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-TTN-Cerulean
Plasmid#128325PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorInsertgRNA against mouse TTN for activation
ExpressionMammalianAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgMark2-mU6-sgMark3-hU6-sgMark4
Plasmid#177235PurposeExpresses Mark2 (bU6), Mark3 (mU6) and Mark4 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgMark2/sgMark3/sgMark4
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-FLAG-HA-T(WT)
Plasmid#181737Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceAug. 3, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177233PurposeExpresses Neomycin (bU6), Ampk1 (mU6) and Ampk2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgPrkaa1/sgPrkaa2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_2nd
Plasmid#177230PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_2nd
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_1st
Plasmid#177227PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_1st
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLR05_pGuide_B2M_sgRNA1
Plasmid#131090PurposesgRNA for SpCas9 mediated B2M KODepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSUPERpuro-HsTNRC6A_Q
Plasmid#147327PurposeMammalian Expression of HsTNRC6A-shRNADepositorInsertHsTNRC6A-shRNA (TNRC6A Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgLkb1_2nd-hU6-sgNT
Plasmid#177229PurposeExpresses Neomycin (bU6), Lkb1 (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgLkb1_2nd/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgLkb1_1st-mU6-sgNeo1-hU6-sgNT
Plasmid#177225PurposeExpresses Lkb1(bU6), neomycin (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgLkb1_1st/sgNeo1/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgLkb1_1st-hU6-sgNT
Plasmid#177226PurposeExpresses Neomycin (bU6), Lkb1 (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgLkb1_1st/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgLkb1_2nd-mU6-sgNeo1-hU6-sgNT
Plasmid#177228PurposeExpresses Lkb1(bU6), neomycin (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgLkb1_2nd/sgNeo1/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only